CC-5444 ∆uvr8-∆phot-D5 mt- [PH067]


From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a PHOT/ UVR8 double disruption strain, generated with CRISPR/Cas9.

Background strain  CC-5440 ∆UVR8-I8-E4 (based on CC-3403)
Nuclease                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                       pAPHVIII (pPH75)
Target gene              PHOT, Cre03.g199000
Target sequence     GACTGGATATGGACCCGATGAGG (Exon 2)


CC-5440 ∆UVR8-I8-E4 mt- [PH050] strain info:
Marker                       pArg
Target gene              UVR8, Cre05.g230600
Target sequence     CGAGGACAGATCTACAGCTGGGG (Exon2)


Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit for more info or contact

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518