* The listed price of $20.00 for cultures and plasmids is for academic and non-profit users. Commercial and industrial users are charged $200.00 for each strain or plasmid and twice the listed price for media components. BACs and fosmids are $50.00 for academic and non-profit users and $500 for commercial/industry. For the Jonikas CLiP mutants, the price is $100.00 each for academic and non-profit users and commercial and industrial users are charged $1000.00. Subscriptions cannot be used for CLiP mutants, BACs nor fosmids.

CC-5446 ∆Phot ∆UVR8-B3 mt+ [PH130]

Name: CC-5446 ∆Phot ∆UVR8-B3 mt+ [PH130]
SKU: CC-5446
Price: 20.00 USD
Availability: InStock

$20.00

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December

This is a PHOT/ UVR8 double disruption strain, generated with CRISPR/Cas9.

Background strain   CC-5392 ∆PHOT-B5 [PH15] (based on CC-125)
Nuclease (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                       pAPHVIII (pPH75)
Target gene   UVR8, Cre05.g230600
Target sequence     CGGCGTCACAGTGACGAGTGTGG (Exon 6)

CC-5392 ∆PHOT-B5 [PH15] strain info:
Marker                       pAphVII (pPH360)
Target gene   PHOT, Cre03.g199000
Target sequence     GCGCATCCTCAACTACACCAAGG (Exon 6)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

CC-5446 ∆Phot ∆UVR8-B3 mt+ [PH130]

Products

Support

Banner Photo Credit: Chlamydomonas reinhardtii zygotes were stained for immunofluorescence with anti-acetylated tubulin (green), anti-phospholipase D (red), and DAPI (blue) by Karl F. Lechtreck (University of Georgia) and George B. Witman (University of Massachusetts Medical School).

Any opinions, findings, and conclusions or recommendations expressed on this website are those of the author(s) and do not necessarily reflect the views of the National Science Foundation.

Cart