CC-5447 ∆Phot ∆UVR8-H9 mt+ [PH131]

$20.00

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a PHOT/ UVR8 double disruption strain, generated with CRISPR/Cas9.

Background strain   CC-5392 ∆PHOT-B5 [PH15] (based on CC-125)
Nuclease                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                       pAPHVIII (pPH075)
Target gene              UVR8, Cre05.g230600
Target sequence     CGGCGTCACAGTGACGAGTGTGG (Exon 6)

 

CC-5392 ∆PHOT-B5 [PH15] strain info:
Marker                       pAphVII (pPH360)
Target gene              PHOT, Cre03.g199000
Target sequence     GCGCATCCTCAACTACACCAAGG (Exon 6)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.