CC-5499 ∆ChR1 ∆ChR2 [PH128]

$20.00

From Heide Evers, Peter Hegemann lab, Humboldt University-Berlin, March 2019

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, March 2019
This is a ChR1 /ChR2 disruption strain, generated with CRISPR/Cas9. 
Background strain               CC-125
Nuclease                               (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                   pAPHVIII (p114), pAPHVII (p360)
Target gene                           ChR1 (COP3), Cre14.g611300
ChR2 (COP4), Cre02.g085257
Target sequence                  ChR1: TGTGGCTTCGTTACGCGGAGTGG (Exon5)
ChR2: GCTCGCGCCCAACGGCACTCAGG (Exon1)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact us if you want to use it.


  • Locus:
  • ChR1, ChR2
  • Chromosome:
  • 14, 2
  • Mutation Information:
  • Predicted Mutation Effect: