Strains
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, May 2024
This is an ARL11 disruption strain, generated with SpCas9 in the CC-3403 background.
Background strain:CC-3403
Nuclease:SpCas9
Target gene: ARL11 Cre12.g487850
Target sequence: ATCCTCTACAAGCTTCACAT
Marker: pHR11
This strain was published in Wolfram et al doi.org/10.22541/au.171488985.58752434/v1. If you use the strain, please cite it accordingly.
Wolfram M, Greif A, Baidukova O, Voll H, Tauber S, Lindacher J, Hegemann P, Kreimer G. Insights into degradation and targeting of the photoreceptor channelrhodopsin-1. Plant Cell Environ. 2024 Jun 27. doi: 10.1111/pce.15017. Epub ahead of print. PMID: 38935876.
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, May 2024
This is a CEP1 disruption strain, generated with SpCas9 in the CC-3403 background.
Background strain: CC-3403
Nuclease: SpCas9
Target gene: CEP1 Cre09.g407700
Target sequence: AAGATGGCTCTTAGATTGCT
Marker: pHR11
This strain was published in Wolfram et al doi.org/10.22541/au.171488985.58752434/v1doi.org/10.22541/au.171488985.58752434/v1. If you use the strain, please cite it accordingly.
Wolfram M, Greif A, Baidukova O, Voll H, Tauber S, Lindacher J, Hegemann P, Kreimer G. Insights into degradation and targeting of the photoreceptor channelrhodopsin-1. Plant Cell Environ. 2024 Jun 27. doi: 10.1111/pce.15017. Epub ahead of print. PMID: 38935876.
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, May 2024
This is a CEP disruption strain, generated with SpCas9 in the CC3403 background.
Background strain: CC-3403
Nuclease: SpCas9
Target gene: CEP1 Cre09.g407700
Target sequence: TTCTTGCGCCAATCGATGGC
Marker: pHR11
This strain was published in Wolfram et al doi.org/10.22541/au.171488985.58752434/v1. If you use the strain, please cite it accordingly.
Wolfram M, Greif A, Baidukova O, Voll H, Tauber S, Lindacher J, Hegemann P, Kreimer G. Insights into degradation and targeting of the photoreceptor channelrhodopsin-1. Plant Cell Environ. 2024 Jun 27. doi: 10.1111/pce.15017. Epub ahead of print. PMID: 38935876.
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, May 2024
This is a CEP disruption strain, generated with SpCas9 in the CC-3403 background.
Background strain: CC-3403
Nuclease: SpCas9
Target gene: CEP1 Cre09.g407700
Target sequence: AAGATGGCTCTTAGATTGCT
Marker: pHR11
This strain was published in Wolfram et al doi.org/10.22541/au.171488985.58752434/v1. If you use the strain, please cite it accordingly.
Wolfram M, Greif A, Baidukova O, Voll H, Tauber S, Lindacher J, Hegemann P, Kreimer G. Insights into degradation and targeting of the photoreceptor channelrhodopsin-1. Plant Cell Environ. 2024 Jun 27. doi: 10.1111/pce.15017. Epub ahead of print. PMID: 38935876.
From Abhishek Gupta, Stephen Mayfield lab, University of California-San Diego, July 2024
Evolved Chlamydomonas strain using mutagenesis, breeding, and selection to have a higher tolerance to light, salinity, temperature and pH.
Gupta A, Dutra Molino JV, Wnuk-Fink KMJ, Bruckbauer A, Tessman M, Kang K, Diaz CJ, Saucedo B, Malik A, Burkart MD, Mayfield SP. Engineering the Novel Extremophile Alga Chlamydomonas pacifica for High Lipid and High Starch Production as a Path to Developing Commercially Relevant Strains. ACS ES T Eng. 2024 Nov 25;5(1):36-49. doi: 10.1021/acsestengg.4c00443. PMID: 39816185; PMCID: PMC11730947.
From Liat Adler, Adrien Bulacot lab, Carnegie Institution for Science, Stanford CA, July 2024
BST4 is a bestrophin-like protein localized to the pyrenoid tubules. This mutant displays enhanced ROS production in light and dies under fluctuating light. It is resistant paromomycin.
Adler L, Lau CS, Shaikh KM, van Maldegem KA, Payne-Dwyer AL, Lefoulon C, Girr P, Atkinson N, Barrett J, Emrich-Mills TZ, Dukic E, Blatt MR, Leake MC, Peltier G, Spetea C, Burlacot A, McCormick AJ, Mackinder LCM, Walker CE. Bestrophin-like protein 4 is involved in photosynthetic acclimation to light fluctuations in Chlamydomonas. Plant Physiol. 2024 Sep 6:kiae450. doi: 10.1093/plphys/kiae450. Epub ahead of print. PMID: 39240724.
Xiaobo Li, Weronika Patena, Friedrich Fauser, Robert E. Jinkerson, Shai Saroussi, Moritz T. Meyer, Nina Ivanova, Jacob M. Robertson, Rebecca Yue, Ru Zhang, Josep Vilarrasa-Blasi, Tyler M. Wittkopp, Silvia Ramundo, Sean R. Blum, Audrey Goh, Matthew Laudon, Tharan Srikumar, Paul A. Lefebvre, Arthur R. Grossman & Martin C. Jonikas (2019) A genome-wide algal mutant library and functional screen identifies genes required for eukaryotic photosynthesis. Nature Genetics 51, 627-635.
From Liat Adler, Adrien Bulacot lab, Carnegie Institution for Science, Stanford CA, July 2024
This is a complemented line for the bst4 CLiP mutant (CC-6191) and is resistant to hygromycin and paromomycin.
Adler L, Lau CS, Shaikh KM, van Maldegem KA, Payne-Dwyer AL, Lefoulon C, Girr P, Atkinson N, Barrett J, Emrich-Mills TZ, Dukic E, Blatt MR, Leake MC, Peltier G, Spetea C, Burlacot A, McCormick AJ, Mackinder LCM, Walker CE. Bestrophin-like protein 4 is involved in photosynthetic acclimation to light fluctuations in Chlamydomonas. Plant Physiol. 2024 Sep 6:kiae450. doi: 10.1093/plphys/kiae450. Epub ahead of print. PMID: 39240724.
From Liat Adler, Adrien Bulacot lab, Carnegie Institution for Science, Stanford CA, July 2024
This is the bst4 CLiP mutant (CC-6191) complemented with a truncated version of BST4, where the disordered C-terminus is removed. It is resistant to hygromycin and paromomycin.
Adler L, Lau CS, Shaikh KM, van Maldegem KA, Payne-Dwyer AL, Lefoulon C, Girr P, Atkinson N, Barrett J, Emrich-Mills TZ, Dukic E, Blatt MR, Leake MC, Peltier G, Spetea C, Burlacot A, McCormick AJ, Mackinder LCM, Walker CE. Bestrophin-like protein 4 is involved in photosynthetic acclimation to light fluctuations in Chlamydomonas. Plant Physiol. 2024 Sep 6:kiae450. doi: 10.1093/plphys/kiae450. Epub ahead of print. PMID: 39240724.
From Liat Adler, Adrien Bulacot lab, Carnegie Institution for Science, Stanford CA, July 2024
This strain is paromycin resistant and sensitive to fluctuating light.
Adler L, Lau CS, Shaikh KM, van Maldegem KA, Payne-Dwyer AL, Lefoulon C, Girr P, Atkinson N, Barrett J, Emrich-Mills TZ, Dukic E, Blatt MR, Leake MC, Peltier G, Spetea C, Burlacot A, McCormick AJ, Mackinder LCM, Walker CE. Bestrophin-like protein 4 is involved in photosynthetic acclimation to light fluctuations in Chlamydomonas. Plant Physiol. 2024 Sep 6:kiae450. doi: 10.1093/plphys/kiae450. Epub ahead of print. PMID: 39240724.
From Liat Adler, Adrien Bulacot lab, Carnegie Institution for Science, Stanford CA, July 2024
This strain is paromycin resistant and sensitive to fluctuating light.
Adler L, Lau CS, Shaikh KM, van Maldegem KA, Payne-Dwyer AL, Lefoulon C, Girr P, Atkinson N, Barrett J, Emrich-Mills TZ, Dukic E, Blatt MR, Leake MC, Peltier G, Spetea C, Burlacot A, McCormick AJ, Mackinder LCM, Walker CE. Bestrophin-like protein 4 is involved in photosynthetic acclimation to light fluctuations in Chlamydomonas. Plant Physiol. 2024 Sep 6:kiae450. doi: 10.1093/plphys/kiae450. Epub ahead of print. PMID: 39240724.
From Abhishek Gupta and Joao Vitor Dutra Molino, Stephen Mayfield lab, University of San Diego, August 2024
Chlamydomonas pacifica CC-5697, transformed with the vector pJPSHx1 PHL7. This strain is resistant to hygromycin due to the incorporation of the aph7” gene and expresses the plastic-degrading enzyme PHL7, which is directed to the secretory pathway via the SP7 signal peptide.
The strain is cultivated on either TAP (Tris-Acetate-Phosphate) or HSM (High Salt Minimal) media and can efficiently assimilate acetate as a carbon source. It utilizes various nitrogen sources, including nitrate, ammonia, and urea, making it versatile for different growth conditions.
For further details on the background of Chlamydomonas pacifica CC-5697, including its extremophilic properties and potential for biotechnology applications, please refer to the publication below.
Dataset info: https://doi.org/10.5281/zenodo.14020362
Dutra Molino JV, Oliver A, Sethuram H, Kang K, Saucedo B, Diaz CJ, Gupta A, Jen LJ, Torres-Tiji Y, Hidasi N, Badary A. Description of a novel extremophile green algae, Chlamydomonas pacifica, and its potential as a biotechnology host. bioRxiv. 2024:2024-09.
From Abhishek Gupta and Joao Vitor Dutra Molino, Stephen Mayfield lab, University of San Diego, August 2024
Chlamydomonas pacifica CC-5697, transformed with the vector pJPCHx1_mVenus. This strain is resistant to hygromycin due to the incorporation of the aph7” gene. The fluorescent protein mVenus expression was low when tested by a plate reader.
The strain is cultivated on either TAP (Tris-Acetate-Phosphate) or HSM (High Salt Minimal) media and can efficiently assimilate acetate as a carbon source. It utilizes various nitrogen sources, including nitrate, ammonia, and urea, making it versatile for different growth conditions.
For further details on the background of Chlamydomonas pacifica CC-5697, including its extremophilic properties and potential for biotechnology applications, please refer to the publication below.
Dataset info: https://doi.org/10.5281/zenodo.14020362
Dutra Molino JV, Oliver A, Sethuram H, Kang K, Saucedo B, Diaz CJ, Gupta A, Jen LJ, Torres-Tiji Y, Hidasi N, Badary A. Description of a novel extremophile green algae, Chlamydomonas pacifica, and its potential as a biotechnology host. bioRxiv. 2024:2024-09.
From Abhishek Gupta and Joao Vitor Dutra Molino, Stephen Mayfield lab, University of San Diego, August 2024
Chlamydomonas pacifica CC-5699, transformed with the vector pAH04mCherry. This strain is resistant to zeocin due to the incorporation of the bleomycin resistance gene and expresses the fluorescent protein mCherry, which is directed to the cytoplasm.
The strain is cultivated on either TAP (Tris-Acetate-Phosphate) or HSM (High Salt Minimal) media and can efficiently assimilate acetate as a carbon source. It utilizes various nitrogen sources, including nitrate, ammonia, and urea, making it versatile for different growth conditions.
For further details on the background of Chlamydomonas pacifica CC-5697, including its extremophilic properties and potential for biotechnology applications, please refer to the publication below.
Dataset info: https://doi.org/10.5281/zenodo.14020362
Dutra Molino JV, Oliver A, Sethuram H, Kang K, Saucedo B, Diaz CJ, Gupta A, Jen LJ, Torres-Tiji Y, Hidasi N, Badary A. Description of a novel extremophile green algae, Chlamydomonas pacifica, and its potential as a biotechnology host. bioRxiv. 2024:2024-09.
From Abhishek Gupta and Joao Vitor Dutra Molino, Stephen Mayfield lab, University of San Diego, August 2024
Chlamydomonas pacifica CC-5699, transformed with the vector pJP32PHL7. This strain is resistant to zeocin due to the incorporation of the bleomycin resistance gene and expresses the plastic degrading enzyme PHL7, which is directed to the secretory pathway via the SP7 signal peptide.
The strain is cultivated on either TAP (Tris-Acetate-Phosphate) or HSM (High Salt Minimal) media and can efficiently assimilate acetate as a carbon source. It utilizes various nitrogen sources, including nitrate, ammonia, and urea, making it versatile for different growth conditions.
For further details on the background of Chlamydomonas pacifica CC-5697, including its extremophilic properties and potential for biotechnology applications, please refer to the publication below.
Dataset info: https://doi.org/10.5281/zenodo.14020362
Dutra Molino JV, Oliver A, Sethuram H, Kang K, Saucedo B, Diaz CJ, Gupta A, Jen LJ, Torres-Tiji Y, Hidasi N, Badary A. Description of a novel extremophile green algae, Chlamydomonas pacifica, and its potential as a biotechnology host. bioRxiv. 2024:2024-09.
From Abhishek Gupta and Joao Vitor Dutra Molino, Stephen Mayfield lab, University of San Diego, August 2024
Chlamydomonas reinhardtii CC-1690, transformed with the vector pAH04mCherry. This strain is resistant to zeocin due to the incorporation of the bleomycin resistance gene and expresses the fluorescent protein mCherry in the cytoplasm.
The strain is cultivated on either TAP (Tris-Acetate-Phosphate) or HSM (High Salt Minimal) media and can efficiently assimilate acetate as a carbon source. It utilizes various nitrogen sources, including nitrate, ammonia, and urea, making it versatile for different growth conditions.
Dataset info: https://doi.org/10.5281/zenodo.14020362
Molino JV, de Carvalho JC, Mayfield SP. Comparison of secretory signal peptides for heterologous protein expression in microalgae: Expanding the secretion portfolio for Chlamydomonas reinhardtii. PLoS One. 2018 Feb 6;13(2):e0192433.
From Abhishek Gupta and Joao Vitor Dutra Molino, Stephen Mayfield lab, University of San Diego, August 2024
Chlamydomonas reinhardtii CC-1690, transformed with the vector pJP32mCherry. This strain is resistant to zeocin due to the incorporation of the bleomycin resistance gene. It expresses the fluorescent protein mCherry, which is directed to the secretory pathway via the SP7 signal peptide.
The strain is cultivated on either TAP (Tris-Acetate-Phosphate) or HSM (High Salt Minimal) media and can efficiently assimilate acetate as a carbon source. It utilizes various nitrogen sources, including nitrate, ammonia, and urea, making it versatile for different growth conditions.
Dataset info: https://doi.org/10.5281/zenodo.14020362
Molino JV, de Carvalho JC, Mayfield SP. Comparison of secretory signal peptides for heterologous protein expression in microalgae: Expanding the secretion portfolio for Chlamydomonas reinhardtii. PLoS One. 2018 Feb 6;13(2):e0192433.
From Abhishek Gupta and Joao Vitor Dutra Molino, Stephen Mayfield lab, University of San Diego, August 2024
Chlamydomonas reinhardtii CC-1690, transformed with the vector pJP32mCherry_His. This strain is resistant to zeocin due to the incorporation of the bleomycin resistance gene. It expresses the fluorescent protein mCherry plus 6xHis tag, which is directed to the secretory pathway via the SP7 signal peptide.
The strain is cultivated on either TAP (Tris-Acetate-Phosphate) or HSM (High Salt Minimal) media and can efficiently assimilate acetate as a carbon source. It utilizes various nitrogen sources, including nitrate, ammonia, and urea, making it versatile for different growth conditions.
Dataset info: https://doi.org/10.5281/zenodo.14020362
Kang, K., Do Espirito Santo, É., Diaz, C. J., Oliver, A., Saxton, L., May, L., Mayfield, S., & Dutra Molino, J. V. (2024). Establishing the green algae Chlamydomonas incerta as a platform for recombinant protein production.
https://doi.org/10.1101/2024.10.25.618925
From Abhishek Gupta and Joao Vitor Dutra Molino, Stephen Mayfield lab, University of San Diego, August 2024
Chlamydomonas reinhardtii CC-1690, transformed with the vector pJP32PHL7. This strain is resistant to zeocin due to the incorporation of the bleomycin resistance gene and expresses the plastic degrading enzyme PHL7, which is directed to the secretory pathway via the SP7 signal peptide.
The strain is cultivated on either TAP (Tris-Acetate-Phosphate) or HSM (High Salt Minimal) media and can efficiently assimilate acetate as a carbon source. It utilizes various nitrogen sources, including nitrate, ammonia, and urea, making it versatile for different growth conditions.
For further details on Chlamydomonas reinhardtii CC-1690 pJP32PHL7, please refer to the publication below.
Dataset info: https://doi.org/10.5281/zenodo.14020362
Molino JV, Saucedo B, Kang K, Walsh C, Diaz CJ, Tessman M, Mayfield SP. Efficient secretion of a plastic degrading enzyme from the green algae Chlamydomonas reinhardtii. bioRxiv. 2024:2024-10.
From Abhishek Gupta and Joao Vitor Dutra Molino, Stephen Mayfield lab, University of San Diego, August 2024
Chlamydomonas reinhardtii CC-1690, transformed with the vector pJPW2_mCherry. This strain is resistant to zeocin due to the incorporation of the bleomycin resistance gene and expresses the fluorescent protein mCherry, which is directed to the cell wall via the SP7 signal peptide and linkage to a GP1, hydroxyproline-rich protein hypothesized to be attached to the cell wall by non-covalent interactions.
The strain is cultivated on either TAP (Tris-Acetate-Phosphate) or HSM (High Salt Minimal) media and can efficiently assimilate acetate as a carbon source. It utilizes various nitrogen sources, including nitrate, ammonia, and urea, making it versatile for different growth conditions.
Dataset info: https://doi.org/10.5281/zenodo.14020362
Molino JV, Carpine R, Gademann K, Mayfield S, Sieber S. Development of a cell surface display system in Chlamydomonas reinhardtii. Algal Research. 2022 Jan 1;61:102570.
From Abhishek Gupta and Joao Vitor Dutra Molino, Stephen Mayfield lab, University of San Diego, August 2024
Chlamydomonas reinhardtii CC-1690, transformed with the vector pJPW4_mCherry. This strain is resistant to zeocin due to the incorporation of the bleomycin resistance gene and expresses the fluorescent protein mCherry, which is directed to the cell wall via the SP7 signal peptide and linkage to a GP1, hydroxyproline-rich protein hypothesized to be attached to the cell wall by non-covalent interactions. A pH-sensitive intein is placed between mCherry and the GP1 protein and appears to release mCherry from the cell wall at lower pH <6.
The strain is cultivated on either TAP (Tris-Acetate-Phosphate) or HSM (High Salt Minimal) media and can efficiently assimilate acetate as a carbon source. It utilizes various nitrogen sources, including nitrate, ammonia, and urea, making it versatile for different growth conditions.
Dataset info: https://doi.org/10.5281/zenodo.14020362
From Abhishek Gupta and Joao Vitor Dutra Molino, Stephen Mayfield lab, University of San Diego, August 2024
Chlamydomonas incerta CC-3871, transformed with the vector pAH04mCherry. This strain is resistant to zeocin due to the incorporation of the bleomycin resistance gene and expresses the fluorescent protein mCherry, which is directed to the cytoplasm.
The strain is cultivated on either TAP (Tris-Acetate-Phosphate) or HSM (High Salt Minimal) media and can efficiently assimilate acetate as a carbon source.
Dataset info: https://doi.org/10.5281/zenodo.14020362
Kang, K., Do Espirito Santo, É., Diaz, C. J., Oliver, A., Saxton, L., May, L., Mayfield, S., & Dutra Molino, J. V. (2024). Establishing the green algae Chlamydomonas incerta as a platform for recombinant protein production. https://doi.org/10.1101/2024.10.25.618925
Molino JV, de Carvalho JC, Mayfield SP. Comparison of secretory signal peptides for heterologous protein expression in microalgae: Expanding the secretion portfolio for Chlamydomonas reinhardtii. PLoS One. 2018 Feb 6;13(2):e0192433.
From Abhishek Gupta and Joao Vitor Dutra Molino, Stephen Mayfield lab, University of San Diego, August 2024
Chlamydomonas incerta CC-3871, transformed with the vector pJP32mCherry_His. This strain is resistant to zeocin due to the incorporation of the bleomycin resistance gene and expresses the fluorescent protein mCherry, which is directed to the secretory pathway via the SP7 signal peptide.
The strain is cultivated on either TAP (Tris-Acetate-Phosphate) or HSM (High Salt Minimal) media and can efficiently assimilate acetate as a carbon source.
Dataset info: https://doi.org/10.5281/zenodo.14020362
Kang, K., Do Espirito Santo, É., Diaz, C. J., Oliver, A., Saxton, L., May, L., Mayfield, S., & Dutra Molino, J. V. (2024). Establishing the green algae Chlamydomonas incerta as a platform for recombinant protein production.
https://doi.org/10.1101/2024.10.25.618925
Molino JV, de Carvalho JC, Mayfield SP. Comparison of secretory signal peptides for heterologous protein expression in microalgae: Expanding the secretion portfolio for Chlamydomonas reinhardtii. PLoS One. 2018 Feb 6;13(2):e0192433.
From Abhishek Gupta and Joao Vitor Dutra Molino, Stephen Mayfield lab, University of San Diego, August 2024
Chlamydomonas incerta CC-3871, transformed with the vector pJPM1_mCherry. This strain is resistant to zeocin due to the incorporation of the bleomycin resistance gene and expresses the fluorescent protein mCherry, which is directed to the cell membrane via the SP2 ARS1 signal peptide and last 49 amino acids of MAW8, a lipid-anchored protein that contains a putative GP1 anchoring signal.
The strain is cultivated on either TAP (Tris-Acetate-Phosphate) or HSM (High Salt Minimal) media and can efficiently assimilate acetate as a carbon source.
Dataset info: https://doi.org/10.5281/zenodo.14020362
Kang, K., Do Espirito Santo, É., Diaz, C. J., Oliver, A., Saxton, L., May, L., Mayfield, S., & Dutra Molino, J. V. (2024). Establishing the green algae Chlamydomonas incerta as a platform for recombinant protein production.
https://doi.org/10.1101/2024.10.25.618925
Molino JV, Carpine R, Gademann K, Mayfield S, Sieber S. Development of a cell surface display system in Chlamydomonas reinhardtii. Algal Research. 2022 Jan 1;61:102570.
From Abhishek Gupta and Joao Vitor Dutra Molino, Stephen Mayfield lab, University of San Diego, August 2024
Chlamydomonas incerta CC-3871, transformed with the vector pJPW2_mCherry. This strain is resistant to zeocin due to the incorporation of the bleomycin resistance gene and expresses the fluorescent protein mCherry, which is directed to the cell wall via the SP7 signal peptide and linkage to a GP1, hydroxyproline-rich protein hypothesized to be attached to the cell wall by non-covalent interactions.
The strain is cultivated on either TAP (Tris-Acetate-Phosphate) or HSM (High Salt Minimal) media and can efficiently assimilate acetate as a carbon source.
Dataset info: https://doi.org/10.5281/zenodo.14020362
Kang, K., Do Espirito Santo, É., Diaz, C. J., Oliver, A., Saxton, L., May, L., Mayfield, S., & Dutra Molino, J. V. (2024). Establishing the green algae Chlamydomonas incerta as a platform for recombinant protein production.
https://doi.org/10.1101/2024.10.25.618925
Molino JV, Carpine R, Gademann K, Mayfield S, Sieber S. Development of a cell surface display system in Chlamydomonas reinhardtii. Algal Research. 2022 Jan 1;61:102570.
From Abhishek Gupta and Joao Vitor Dutra Molino, Stephen Mayfield lab, University of San Diego, August 2024
Progeny of Chlamydomonas reinhardtii CC-620 pJPW2_mCherry and fused to Chlamydomonas pacifica CC-5697 pJPSHx1 PHL7, from João Vitor Dutra Molino at the Stephen Mayfield Laboratory, University of California, San Diego (September 2024). This strain is resistant to zeocin due to the incorporation of the bleomycin resistance gene and resistant to hygromycin due to the incorporation of the aph7” gene. It expresses PHL7 which is directed to the secretory pathway via the SP7 signal peptide and expresses the fluorescent protein mCherry (Cell wall localization was not confirmed).
Dataset info: https://doi.org/10.5281/zenodo.14020362
From Abhishek Gupta and Joao Vitor Dutra Molino, Stephen Mayfield lab, University of San Diego, August 2024
Progeny of Chlamydomonas reinhardtii CC-1690 pJPW2_mCherry and fused to Chlamydomonas pacifica CC-5697 pJPSHx1 PHL7, from João Vitor Dutra Molino at the Stephen Mayfield Laboratory, University of California, San Diego (September 2024). This strain is resistant to zeocin due to the incorporation of the bleomycin resistance gene and resistant to hygromycin due to the incorporation of the aph7” gene. It expresses PHL7 which is directed to the secretory pathway via the SP7 signal peptide and expresses the fluorescent protein mCherry (Cell wall localization was not confirmed).
Dataset info: https://doi.org/10.5281/zenodo.14020362
From Abhishek Gupta and Joao Vitor Dutra Molino, Stephen Mayfield lab, University of San Diego, August 2024
Progeny of Chlamydomonas reinhardtii CC-1690 pJPW2_mCherry and fused to Chlamydomonas pacifica CC-5697 pJPSHx1 PHL7, from João Vitor Dutra Molino at the Stephen Mayfield Laboratory, University of California, San Diego (September 2024). This strain is resistant to zeocin due to the incorporation of the bleomycin resistance gene and resistant to hygromycin due to the incorporation of the aph7” gene. It expresses PHL7 which is directed to the secretory pathway via the SP7 signal peptide and expresses the fluorescent protein mCherry (Cell wall localization was not confirmed).
Dataset info: https://doi.org/10.5281/zenodo.14020362
From Abhishek Gupta and Joao Vitor Dutra Molino, Stephen Mayfield lab, University of San Diego, August 2024
Progeny of Chlamydomonas reinhardtii CC-1690 pJPW2_mCherry and fused to Chlamydomonas pacifica CC-5697 pJPSHx1 PHL7, from João Vitor Dutra Molino at the Stephen Mayfield Laboratory, University of California, San Diego (September 2024). This strain is resistant to zeocin due to the incorporation of the bleomycin resistance gene and resistant to hygromycin due to the incorporation of the aph7” gene. It expresses PHL7 which is directed to the secretory pathway via the SP7 signal peptide and expresses the fluorescent protein mCherry (Cell wall localization was not confirmed).
Dataset info: https://doi.org/10.5281/zenodo.14020362
From Abhishek Gupta and Joao Vitor Dutra Molino, Stephen Mayfield lab, University of San Diego, August 2024
Progeny of Chlamydomonas reinhardtii CC-1690 pJPW2_mCherry and fused to Chlamydomonas pacifica CC-5697 pJPSHx1 PHL7, from João Vitor Dutra Molino at the Stephen Mayfield Laboratory, University of California, San Diego (September 2024). This strain is resistant to zeocin due to the incorporation of the bleomycin resistance gene and resistant to hygromycin due to the incorporation of the aph7” gene. It expresses PHL7 which is directed to the secretory pathway via the SP7 signal peptide and expresses the fluorescent protein mCherry (Cell wall localization was not confirmed).
Dataset info: https://doi.org/10.5281/zenodo.14020362
From Adrian Nievergelt, Max-Planck-Institute of Molecular Plant Physiology (MPI-MP), Potsdam, Germany, July 2025
Background: CC-124 32M
Origin: CRISPR-mediated insertional knock-out of FMG1B.
Description: This strain lacks the B-isoform of FMG1 and has no clear phenotype. Nourseothricin resistant.
Locus: FMG1B (Cre09.g392867_4532).
Hoepfner LM, Nievergelt AP, Matrino F, Scholz M, Foster HE, Rodenfels J, von Appen A, Hippler M, Pigino G. Unwrapping the Ciliary Coat: High-Resolution Structure and Function of the Ciliary Glycocalyx. Adv Sci (Weinh). 2025 Apr;12(16):e2413355. doi: 10.1002/advs.202413355. Epub 2025 Mar 5. PMID: 40041987; PMCID: PMC12021028.