Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, May 2024

This is a CEP disruption strain, generated with SpCas9 in the CC-3403 background.

Background strain: CC-3403
Nuclease: SpCas9
Target gene: CEP1 Cre09.g407700
Target sequence: AAGATGGCTCTTAGATTGCT
Marker: pHR11

This strain was published in Wolfram et al doi.org/10.22541/au.171488985.58752434/v1. If you use the strain, please cite it accordingly.


Wolfram M, Greif A, Baidukova O, Voll H, Tauber S, Lindacher J, Hegemann P, Kreimer G. Insights into degradation and targeting of the photoreceptor channelrhodopsin-1. Plant Cell Environ. 2024 Jun 27. doi: 10.1111/pce.15017. Epub ahead of print. PMID: 38935876.