Strains
* The listed price of $30.00 for cultures and plasmids is for academic and non-profit users. Commercial and industrial users are charged $300.00 for each strain or plasmid and twice the listed price for media components. BACs and fosmids are $50.00 for academic and non-profit users and $500 for commercial/industry. For the Jonikas CLiP mutants, the price is $100.00 each for academic and non-profit users and commercial and industrial users are charged $1000.00. Subscriptions cannot be used for CLiP mutants, BACs nor fosmids.
CC-6189 ∆CEP-2 [PH267]
$30.00
$30.00
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, May 2024
This is a CEP disruption strain, generated with SpCas9 in the CC-3403 background.
Background strain: CC-3403
Nuclease: SpCas9
Target gene: CEP1 Cre09.g407700
Target sequence: AAGATGGCTCTTAGATTGCT
Marker: pHR11
This strain was published in Wolfram et al doi.org/10.22541/au.171488985.58752434/v1. If you use the strain, please cite it accordingly.
Wolfram M, Greif A, Baidukova O, Voll H, Tauber S, Lindacher J, Hegemann P, Kreimer G. Insights into degradation and targeting of the photoreceptor channelrhodopsin-1. Plant Cell Environ. 2024 Jun 27. doi: 10.1111/pce.15017. Epub ahead of print. PMID: 38935876.
- «Previous Page
- 1
- …
- 128
- 129
- 130