Search Results for 11/32C
CC-5968 ∆SNRK2.2-C5 [PH158]
$30.00
$30.00
Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, December 2022
This is a SNRK2.2 (SAC3) disruption strain, generated with CRISPR/Cas9. Clone C5-A5.
Mutants with a disrupted SNRK2.2 (SAC3) gene show constitutive arylsulfatase expression and can phenotypically screened with X-SO4 dyes (see Kelterborn et al. 2022, doi.org/10.1007/978-1-0716-1791-5_3).
Background strain: SAG11-32b (=CC-409)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: SNRK2.2, Cre12.g499500
Target sequence: TAGCGAGGATGTCCAATCAG GGG (exon 1)
Mutation: insertion of short oligo (TTAGACTCTAACTAGATCAGcgg)
Overview of all CRISPR/Cas9 strains from the Hegemann lab: http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
CC-5969 ∆SNRK2.2-C10 [PH159]
$30.00
$30.00
Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, December 2022
This is a SNRK2.2 (SAC3) disruption strain, generated with CRISPR/Cas9. Clone C10-A10.
Mutants with a disrupted SNRK2.2 (SAC3) gene show constitutive arylsulfatase expression and can phenotypically screened with X-SO4 dyes (see Kelterborn et al. 2022, doi.org/10.1007/978-1-0716-1791-5_3).
Background strain: SAG11-32b (=CC-409)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: SNRK2.2, Cre12.g499500
Target sequence: TAGCGAGGATGTCCAATCAG GGG (exon 1)
Mutation: insertion of short oligo (TTAGACTCTAACTAGATCAGcgg)
Overview of all CRISPR/Cas9 strains from the Hegemann lab: http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
CC-2420 lor1-101
$30.00
$30.00
From Alexander Chunayev, Leningrad State University, September 1989
Phenotype: carotenoid deficient; requires acetate
This strain should be kept in dim light.
The following notes on lor1-101 were sent by Armino Boschetti in 2001:
“The pg-101 [lor1] mutant was obtained by M. Tellenbach by UV mutation of C. reinhardtii strain 11/32f Levine, mutant Arg2 mt+ (from Culture Collection of Algae and Protozoa, Cambridge UK) and selected for altered color [M. Tellenbach (1984), Herbizidresistenz und Pigmentdefizienz, Ph.D. thesis, University of Bern, Switzerland]. The phenotypical difference detected at first was the lack in loroxanthin on thinlayer chromatograms of pigment extracts. As separation of lutein and zeaxanthin by HPLC as well as confirmation of the absence of low amounts of alpha-carotene is rather difficult, it took us some years to demonstrate that this mutant is not able to produce alpha-ionone rigns in carotenoids (episilon-rings), which means that the alpha cyclase is inactive or missing [A.S. Chunayev et al. (1991). Chlorophyll b- and loroxanthin-deficient mutants of Chlamydomonas reinhardtii, Photosynthetica 25, 291-301]. It was renamed to lor-1 by Chunayev who studied the genetics of this mutant. ”
Eichenberger W, Boschetti A, Michel HP (1986) Lipid and pigment composition of a chlorophyll b-deficient mutant of Chlamydomonas reinhardii. Physiologia Plantarum 66:589-594
Chunaev AS, Mirnaya ON, Maslov VG, Boschetti A (1991) Chlorophyll b- and loroxanthin-deficient mutants of Chlamydomonas reinhardtii. Photosynthetica 25:291-301
Niyogi KK, Björkman O, Grossman AR (1997) The roles of specific xanthophylls in photoprotection. Proc Natl Acad Sci U S A 94:14162-14167
Baroli I, Do AD, Yamane T, Niyogi KK (2003) Zeaxanthin accumulation in the absence of a functional xanthophyll cycle protects Chlamydomonas reinhardtii from photooxidative stress. Plant Cell 15:992-1008
Anwaruzzaman M, Chin BL, Li XP, Lohr M, Martinez DA, Niyogi KK (2004) Genomic analysis of mutants affecting xanthophyll biosynthesis and regulation of photosynthetic light harvesting in Chlamydomonas reinhardtii. Photosynth Res 82:265-276
CC-2419 cbn1-113 [= pg-113]
$30.00
$30.00
From Alexander Chunayev, Leningrad State University, September 1989
Phenotype: somewhat chlorophyll deficient
The pg-113 mutant was isolated by M. Tellenbach in Arminio Boschetti’s laboratory, and subsequently determined in collaboration with Chunayev to be an allele at the CBN1 locus, now known to be equivalent to the CAO1 gene. It is somewhat chlorophyll deficient and should be maintained in dim light.
The following notes on pg-113 were sent by Armino Boschetti in 2001:
“The pg-113 mutant was obtained by M. Tellenbach by UV mutation of C. reinhardtii strain 11/32f Levine, mutant Arg2 mt+ (from Culture Collection of Algae and Protozoa, Cambridge UK) and selected for altered color [M. Tellenbach (1984), Herbizidresistenz und Pigmentdefizienz, Ph.D. thesis, University of Bern, Switzerland]. It was described in several papers, but the mutated gene or gene product is not yet identified. In collaboration with A.S. Chunayev it was shown that this mutant is allelic to his cbn-48-1 mutant, however, the composition of the thylakoid proteins seem to be somehow different. The mutant laks a stable chlorophyll complex II (electrophoresis of partially solubilized thylakoids) and lacks chlorophyll b, but has normal chlorophyll a content. The amount of neoxanthin is reduced. The LHCII proteins are present and are even phosphorylated and dephosphorylated as normal. ”
For more information on cbn1, please see CC-1354.
Michel H, Tellenbach M, Boschetti A (1983) A chlorophyll b-less mutant of Chlamydomonas reinhardii lacking in the light-harvesting chlorophyll complex but not in its apoproteins. Biochim Biophys Acta 725:417-424
CC-1920 fla11 mt-
$30.00
$30.00
From David Luck, Rockefeller University, July 1985
Phenotype: impaired motility
The fla11 mutant slowly resorbs flagella at 32 degrees and is slow to generate flagella when induced to form gametes at 21 degrees. Pedersen et al. determined that this is a point mutation in the gene encoding the IFT172 protein, resulting in a Leu to Pro change at amino acid residue 1615.
Adams GM, Huang B, Luck DJ (1982) Temperature-Sensitive, Assembly-Defective Flagella Mutants of Chlamydomonas Reinhardtii. Genetics 100:579-586
Pedersen LB, Miller MS, Geimer S, Leitch JM, Rosenbaum JL, Cole DG (2005) Chlamydomonas IFT172 is encoded by FLA11, interacts with CrEB1, and regulates IFT at the flagellar tip. Curr Biol 15:262-266
CC-5037 rbcL-Phylo34 mt+
$30.00
$30.00
From Robert J. Spreitzer, University of Nebraska, November 2014
Phenotype: requires acetate, sensitive to light
Using plasmid p699 (GuhaMajumdar et al. 2008), Boon Hoe Lim in Spreitzer’s group performed rbcL direct mutagenesis, chloroplast transformation of wild-type 2137 mt+ (CC-4887), selection for spectinomycin resistance in the dark, and screening for a homoplasmic acetate-requiring phenotype to create 34 substitutions together in the Rubisco large subunit (A11V, V30E, V31T, R32K, M42V, C53A, D86H, I105L, V149Q, G168P, V221C, V235I, C256F, K258R, I265V, I282H, R305K, L326I, V341I, M349L, C369V, M375L, V391T, A398S, C399V, T428V, G442N, D443E, V444I, S447E, D470E, T471A, I472M, and K474T). The mutant lacks Rubisco holoenzyme (Lim and Spreitzer, unpublished). It was created to investigate phylogenetic differences that influence Rubisco catalysis (Du et al. 2003; Spreitzer et al. 2005). This strain has been maintained with acetate medium in darkness to prevent selection for secondary mutations that may improve Rubisco function or suppress light sensitivity (Spreitzer and Ogren 1983).
Du YC, Peddi SR, Spreitzer RJ (2003) Assessment of structural and functional divergence far from the large subunit active site of ribulose-1,5-bisphosphate carboxylase/oxygenase. J Biol Chem 278:49401-49405
GuhaMajumdar M, Dawson-Baglien E, Sears BB (2008) Creation of a chloroplast microsatellite reporter for detection of replication slippage in Chlamydomonas reinhardtii. Eukaryot Cell 7:639-646
Spreitzer RJ, Ogren WL (1983) Nuclear suppressors of the photosensitivity associated with defective photosynthesis in Chlamydomonas reinhardtii. Plant Physiol 71:35-39
Spreitzer RJ, Peddi SR, Satagopan S (2005) Phylogenetic engineering at an interface between large and small subunits imparts land-plant kinetic properties to algal Rubisco. Proc Natl Acad Sci USA 102:17225-17230
LMJ.RY0402.254659
$100.00
$100.00
If you use this mutant for your work, please cite: Li et al. 2019 Nature Genetics.
From the Jonikas lab, Princeton University, 2016
See the mutant page on the CLiP website for detailed insertion information. Summary: this mutant strain has 2 mapped insertions:
1) FAL13 (Cre11.g482050), chromosome_11 base 3613878 (genome v5.5), CDS – WARNING position has 58% probability of being correct
2) MMP32 (Cre14.g625850), chromosome_14 base 2595418 (genome v5.5), 3’UTR – WARNING position has 73% probability of being correct
The listed mapped insertions have a chance of being incorrect (see insertion list for details), and there may be additinal unmapped insertions. If there are two listed insertions in the same locus, they represent two sides of the same insertion. We urge you to confirm that your gene of interest is disrupted by using this PCR protocol. The insertion cassette carries paromomycin resistance, but some insertions may be of cassette fragments lacking the resistance gene.
Xiaobo Li, Weronika Patena, Friedrich Fauser, Robert E. Jinkerson, Shai Saroussi, Moritz T. Meyer, Nina Ivanova, Jacob M. Robertson, Rebecca Yue, Ru Zhang, Josep Vilarrasa-Blasi, Tyler M. Wittkopp, Silvia Ramundo, Sean R. Blum, Audrey Goh, Matthew Laudon, Tharan Srikumar, Paul A. Lefebvre, Arthur R. Grossman & Martin C. Jonikas (2019) A genome-wide algal mutant library and functional screen identifies genes required for eukaryotic photosynthesis. Nature Genetics 51, 627-635.