Search Results for

145 results found matching strain_source: Hegemann

Deposited by Simon Kelterborn and Philipp Sachse, Peter Hegemann lab, Humboldt University of Berlin, November 2020

This is a pCRY disruption in a ROC15-Luc+ reporter strain, generated with CRISPR/Cas9. Clone D5

Background strain: ROC15-Luc+ (from Takuya Matsuo, see Niwa et al. 2013 for details)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
Target gene: pCRY, (Cre06.g295200)
Target sequence: GCGACATGCTGTATGAGCCG TGG (exon 2)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, November 2019

This is a ChR1 ChR2 disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
pAphVII (pPH360)
Target gene: ChR1, Cre14.g611300
ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG TGG (ChR1, exon 5)
CTATGTGTGCGCTATCGAGG TGG (ChR2, exon 4)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

  • Locus:
  • ChR1, ChR2
  • Chromosome:
  • 14, 2

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, November 2019

This is a ChR1 ChR2 disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
pAphVII (pPH360)
Target gene: ChR1, Cre14.g611300
ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG TGG (ChR1, exon 5)
CTATGTGTGCGCTATCGAGG TGG (ChR2, exon 4)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

  • Locus:
  • ChR1, ChR2
  • Chromosome:
  • 14, 2

Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019

This is a ChR1 disruption strain, generated with CRISPR/Cas9. 

Background strain: SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: ChR1, Cre14.g611300
Target sequence: TGTGGCTTCGTTACGCGGAG TGG (exon 5)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

  • Locus:
  • ChR1
  • Chromosome:
  • 14

Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019

This is a CiliK (GCLK1) disruption strain, generated with CRISPR/Cas9. 

Background strain: SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: CiliK/GCLK1, Cre02.g104450
Target sequence: CCGGGATTCGAAGCGACGGA CGG (exon 1)

This strain was generated in a collaboration with Prof. William Snell.

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

  • Locus:
  • CiliK/GCLK1
  • Chromosome:
  • 2

Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019

This is a 4-IPT disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: 4-IPT, Cre17.g717350
Target sequence: GGTGATTGTGACGGGGCCCA CGG (Exon 1)

This strain was generated in a collaboration with Prof. Thomas Roitsch.

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

  • Locus:
  • 4-IPT
  • Chromosome:
  • 17

Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a UVR8 disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: UVR8, Cre05.g230600
Target sequence: CGGCGTCACAGTGACGAGTGTGG (Exon 6)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a COP5 disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-3403 (mt-)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pHR11
Target gene: COP5, Cre02.g074150
Target sequence: GGTGTACTCGGTGATGCTGGCGG (Exon 4)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a COP5 disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-3403 (mt-)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pHR11
Target gene: COP5, Cre02.g074150
Target sequence: GCAGCACCTCCAGACTGACGCGG (Exon 6)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a PHOT disruption strain, generated with CRISPR/Cas9. 

Background strain: SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: PHOT, Cre03.g199000
Target sequence: GACTGGATATGGACCCGATGAGG (Exon2)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a PHOT disruption strain, generated with CRISPR/Cas9. 

Background strain: SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: PHOT, Cre03.g199000
Target sequence: GACTGGATATGGACCCGATGAGG (Exon2)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a COP8 (HKR4) disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-3403 (mt-)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pHR11
Target gene: COP8 (HKR4), Cre07.g329900
Target sequence: GGTGCAGGTCCAGCTTGCTGCGG (Exon2)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a COP8 (HKR4) disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-3403 (mt-)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pHR11
Target gene: COP8 (HKR4), Cre07.g329900
Target sequence: GGTGCAGGTCCAGCTTGCTGCGG (Exon2)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

From Irina Sizova, Hegemann lab, Humboldt University-Berlin, November 2015

Sizova I, Greiner A, Awasthi M, Kateriya S, Hegemann P (2013) Nuclear gene targeting in Chlamydomonas using engineered zinc-finger nucleases. Plant J 73:873-82

From Andre Greiner, Hegemann lab, Humboldt University-Berlin, November 2015

Trippens J, Greiner A, Schellwat J, Neukam M, Rottmann T, Lu Y, Kateriya S, Hegemann P, Kreimer G (2012) Phototropin influence on eyespot development and regulation of phototactic behavior in Chlamydomonas reinhardtii. Plant Cell 24:4687-702

From Andre Greiner, Hegemann lab, Humboldt University-Berlin, November 2015

Trippens J, Greiner A, Schellwat J, Neukam M, Rottmann T, Lu Y, Kateriya S, Hegemann P, Kreimer G (2012) Phototropin influence on eyespot development and regulation of phototactic behavior in Chlamydomonas reinhardtii. Plant Cell 24:4687-702

From Andre Greiner, Hegemann lab, Humboldt University-Berlin, November 2015

Andre Greiner from the Hegemann lab suggests that this strain be re-selected on Zeocin before analysis.

Trippens J, Greiner A, Schellwat J, Neukam M, Rottmann T, Lu Y, Kateriya S, Hegemann P, Kreimer G (2012) Phototropin influence on eyespot development and regulation of phototactic behavior in Chlamydomonas reinhardtii. Plant Cell 24:4687-702

From Andre Greiner, Hegemann lab, Humboldt University-Berlin, November 2015

Trippens J, Greiner A, Schellwat J, Neukam M, Rottmann T, Lu Y, Kateriya S, Hegemann P, Kreimer G (2012) Phototropin influence on eyespot development and regulation of phototactic behavior in Chlamydomonas reinhardtii. Plant Cell 24:4687-702

From Andre Greiner, Hegemann lab, Humboldt University-Berlin, November 2015

Andre Greiner suggests that this strain be re-selected on Zeocin before analysis.

Trippens J, Greiner A, Schellwat J, Neukam M, Rottmann T, Lu Y, Kateriya S, Hegemann P, Kreimer G (2012) Phototropin influence on eyespot development and regulation of phototactic behavior in Chlamydomonas reinhardtii. Plant Cell 24:4687-702

From Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023

From Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023

From Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023

From Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023

From Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023

From Peter Hegemann, Humboldt University, Berlin, July 2012

Phenotype: altered phototaxis

This is the original strain that Bob Smyth isolated in the Ebersold lab. The isolate was derived as a spontaneous cell-wall-less mutant from a single colony of Smyth strain 806. It shows negative phototaxis at all photon irradiances and has some cell-wall defect.

This strain has a weaker cell wall but it is not cell wall deficient. It is relatively stable but has the advantage that it can be lysed in a so-called Yeda Press (also named Parr Bomb) which is much milder that a French Press or Fluidizer. Thus internal membranes can be isolated with higher purity.

Hegemann P, Hegemann U, Foster KW (1988) Reversible bleaching of Chlamydomonas reinhardtii rhodopsin in vivo. Photochem Photobiol 48:123-8