* The listed price of $20.00 for cultures and plasmids is for academic and non-profit users. Commercial and industrial users are charged $200.00 for each strain or plasmid and twice the listed price for media components. BACs and fosmids are $50.00 for academic and non-profit users and $500 for commercial/industry. For the Jonikas CLiP mutants, the price is $100.00 each for academic and non-profit users and commercial and industrial users are charged $1000.00. Subscriptions cannot be used for CLiP mutants, BACs nor fosmids.
CC-5431 ∆COP6-F9 mt+ [PH143]
$20.00
From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018
This is a COP6 (HKR2) disruption strain, generated with CRISPR/Cas9.
Background strain CC-125 mt+
Nuclease (Sp)Cas9 as ribonucleoprotein (RNP)
Marker pAPHVIII (pPH75)
Target gene COP6 (HKR2), Cre11.g467678
Target sequence GTTGTCTTCGAACAAGAGCGAGG (Exon3)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.