From Sunjoo Joo and Jae-Hyeok Lee, University of British Columbia, December 2021


Joo, S., Kariyawasam, T., Kim, M., Jin, ES., Goodenough, U.W., and Lee, J.-H. (2022) Sex-linked deubiquitinase establishes uniparental transmission of chloroplast DNA.

From Sunjoo Joo and Jae-Hyeok Lee, University of British Columbia, December 2021


Joo, S., Kariyawasam, T., Kim, M., Jin, ES., Goodenough, U.W., and Lee, J.-H. (2022) Sex-linked deubiquitinase establishes uniparental transmission of chloroplast DNA.

From Sunjoo Joo and Jae-Hyeok Lee, University of British Columbia, December 2021


Joo, S., Kariyawasam, T., Kim, M., Jin, ES., Goodenough, U.W., and Lee, J.-H. (2022) Sex-linked deubiquitinase establishes uniparental transmission of chloroplast DNA.

From Sunjoo Joo and Jae-Hyeok Lee, University of British Columbia, December 2021


Joo, S., Kariyawasam, T., Kim, M., Jin, ES., Goodenough, U.W., and Lee, J.-H. (2022) Sex-linked deubiquitinase establishes uniparental transmission of chloroplast DNA.

From Minjae Kim, Eonseon Jin, Thamali Kariyawasam and Jae-Hyeok Lee, Hanyang University/University of British Columbia, December 2021


Joo, S., Kariyawasam, T., Kim, M., Jin, ES., Goodenough, U.W., and Lee, J.-H. (2022) Sex-linked deubiquitinase establishes uniparental transmission of chloroplast DNA.

From Minjae Kim, Eonseon Jin, Thamali Kariyawasam and Jae-Hyeok Lee, Hanyang University/University of British Columbia, December 2021


Joo, S., Kariyawasam, T., Kim, M., Jin, ES., Goodenough, U.W., and Lee, J.-H. (2022) Sex-linked deubiquitinase establishes uniparental transmission of chloroplast DNA.

From Sunjoo Joo, Thamali Kariyawasam, and Jae-Hyeok Lee, University of British Columbia, December 2021


Joo, S., Kariyawasam, T., Kim, M., Jin, ES., Goodenough, U.W., and Lee, J.-H. (2022) Sex-linked deubiquitinase establishes uniparental transmission of chloroplast DNA.

From Sunjoo Joo, Thamali Kariyawasam, and Jae-Hyeok Lee, University of British Columbia, December 2021


Joo, S., Kariyawasam, T., Kim, M., Jin, ES., Goodenough, U.W., and Lee, J.-H. (2022) Sex-linked deubiquitinase establishes uniparental transmission of chloroplast DNA.

From Jacob Munz, Moyan Jia, Sunjoo Joo, and Jae-Hyeok Lee, University of British Columbia, December 2021


Jia, M., Munz, J., Lee, J., Shelley, N., Xiong, Y., Joo, S., Jin, ES., and Lee, J.-H. (2022) The bHLH family NITROGEN-REPLETION INSENSITIVE1 represses nitrogen starvation-induced responses in Chlamydomonas reinhardtii.

From Jacob Munz, Moyan Jia, Sunjoo Joo, and Jae-Hyeok Lee, University of British Columbia, December 2021


Jia, M., Munz, J., Lee, J., Shelley, N., Xiong, Y., Joo, S., Jin, ES., and Lee, J.-H. (2022) The bHLH family NITROGEN-REPLETION INSENSITIVE1 represses nitrogen starvation-induced responses in Chlamydomonas reinhardtii.

From Jacob Munz, Moyan Jia, Sunjoo Joo, and Jae-Hyeok Lee, University of British Columbia, December 2021


Jia, M., Munz, J., Lee, J., Shelley, N., Xiong, Y., Joo, S., Jin, ES., and Lee, J.-H. (2022) The bHLH family NITROGEN-REPLETION INSENSITIVE1 represses nitrogen starvation-induced responses in Chlamydomonas reinhardtii.

From Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, December 2021

This is a KU80 disruption strain, generated with SpCas9 based on the CC125 strain.
Background strain CC-125 mt+
Nuclease SpCas9
Target gene KU80 Cre10.g423800
Target sequence CTCAGTGCCGTACAGCACCA
Marker pAphVII (pPH360)

This strain was published in Sizova et al https://doi.org/10.1093/g3journal/jkab114.
Overview of all strains from the Hegemann lab http://www.chlamy.de/strains


Sizova I, Kelterborn S, Verbenko V, Kateriya S, Hegemann P. Chlamydomonas POLQ is necessary for CRISPR/Cas9-mediated gene targeting. G3 (Bethesda). 2021 Apr 9;11(7):jkab114. doi: 10.1093/g3journal/jkab114. Epub ahead of print. PMID: 33836052; PMCID: PMC8495919.

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin,
December 2021

This is a POLQ disruption strain, generated with SpCas9 based on ChR1 disruption strain in CC3403 [PH55].

Background strain CC-3403, ChR1 disruption strain [PH55]
Nuclease SpCas9
Target gene POLQ Cre16.g664300
Target sequence GCATCAGTTGATGGTGACGG
Marker pAphVII (pPH360)
pBle

This strain was published in Sizova et al https://doi.org/10.1093/g3journal/jkab114.
Overview of all strains from the Hegemann lab http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Sizova I, Kelterborn S, Verbenko V, Kateriya S, Hegemann P. Chlamydomonas POLQ is necessary for CRISPR/Cas9-mediated gene targeting. G3 (Bethesda). 2021 Apr 9;11(7):jkab114. doi: 10.1093/g3journal/jkab114. Epub ahead of print. PMID: 33836052; PMCID: PMC8495919.

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, December 2021

This is a KU80 disruption strain, generated with SpCas9 based on ChR1 disruption strain in CC3403 [PH55].

Background strain CC-3403, ChR1 disruption strain [PH55]
Nuclease SpCas9
Target gene KU80 Cre10.g423800
Target sequence tcaagacattaaacaccagg
Marker pAphVII (pPH360)
pBle

This strain was published in Sizova et al https://doi.org/10.1093/g3journal/jkab114.
Overview of all strains from the Hegemann lab http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Sizova I, Kelterborn S, Verbenko V, Kateriya S, Hegemann P. Chlamydomonas POLQ is necessary for CRISPR/Cas9-mediated gene targeting. G3 (Bethesda). 2021 Apr 9;11(7):jkab114. doi: 10.1093/g3journal/jkab114. Epub ahead of print. PMID: 33836052; PMCID: PMC8495919.

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin,
December 2021
This is a KU80 disruption strain, generated with SpCas9 based on ChR1 disruption strain in CC3403 [PH55].

Background strain CC-3403, ChR1 disruption strain [PH55]
Nuclease SpCas9
Target gene KU80 Cre10.g423800
Target sequence tcaagacattaaacaccagg
Marker pAphVII (pPH360)
pBle

This strain was published in Sizova et al https://doi.org/10.1093/g3journal/jkab114.
Overview of all strains from the Hegemann lab http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Sizova I, Kelterborn S, Verbenko V, Kateriya S, Hegemann P. Chlamydomonas POLQ is necessary for CRISPR/Cas9-mediated gene targeting. G3 (Bethesda). 2021 Apr 9;11(7):jkab114. doi: 10.1093/g3journal/jkab114. Epub ahead of print. PMID: 33836052; PMCID: PMC8495919.

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin,
December 2021
This is a ∆KU70 disruption strain, generated with SpCas9 based on ChR1 disruption strain in CC3403 [PH55].

Background strain CC-3403, ChR1 disruption strain [PH55]
Nuclease SpCas9
Target gene KU70 Cre13.g607500
Target sequence GTCGTTTGAGAACACCACAA
Marker pAphVII (pPH360)
pBle

This strain was published in Sizova et al https://doi.org/10.1093/g3journal/jkab114.
Overview of all strains from the Hegemann lab http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Sizova I, Kelterborn S, Verbenko V, Kateriya S, Hegemann P. Chlamydomonas POLQ is necessary for CRISPR/Cas9-mediated gene targeting. G3 (Bethesda). 2021 Apr 9;11(7):jkab114. doi: 10.1093/g3journal/jkab114. Epub ahead of print. PMID: 33836052; PMCID: PMC8495919.

From Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, December 2021

This is a KU80 disruption strain, generated with SpCas9 based on the CC125 strain.
Background strain CC-125 mt+
Nuclease SpCas9
Target gene KU80 Cre10.g423800
Target sequence CTCAGTGCCGTACAGCACCA
Marker pAphVII (pPH360)

This strain was published in Sizova et al https://doi.org/10.1093/g3journal/jkab114.
Overview of all strains from the Hegemann lab http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Sizova I, Kelterborn S, Verbenko V, Kateriya S, Hegemann P. Chlamydomonas POLQ is necessary for CRISPR/Cas9-mediated gene targeting. G3 (Bethesda). 2021 Apr 9;11(7):jkab114. doi: 10.1093/g3journal/jkab114. Epub ahead of print. PMID: 33836052; PMCID: PMC8495919.

From Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, December 2021

This is a POLQ disruption strain, generated with SpCas9 based on the CC125 strain.
Background strain CC-125 mt+
Nuclease SpCas9
Target gene POLQ Cre16.g664300
Target sequence GCCGCGCCATCCACATTGCT
Marker pAphVII (pPH360)

This strain was published in Sizova et al https://doi.org/10.1093/g3journal/jkab114.
Overview of all strains from the Hegemann lab http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Sizova I, Kelterborn S, Verbenko V, Kateriya S, Hegemann P. Chlamydomonas POLQ is necessary for CRISPR/Cas9-mediated gene targeting. G3 (Bethesda). 2021 Apr 9;11(7):jkab114. doi: 10.1093/g3journal/jkab114. Epub ahead of print. PMID: 33836052; PMCID: PMC8495919.

From Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, December 2021

This is a ∆KU70 disruption strain, generated with SpCas9 based on the CC125 strain.
Background strain CC-125 mt+
Nuclease SpCas9
Target gene KU70 Cre13.g607500
Target sequence GTCGTTTGAGAACACCACAA
Marker pAphVII (pPH360)

This strain was published in Sizova et al https://doi.org/10.1093/g3journal/jkab114.
Overview of all strains from the Hegemann lab http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Sizova I, Kelterborn S, Verbenko V, Kateriya S, Hegemann P. Chlamydomonas POLQ is necessary for CRISPR/Cas9-mediated gene targeting. G3 (Bethesda). 2021 Apr 9;11(7):jkab114. doi: 10.1093/g3journal/jkab114. Epub ahead of print. PMID: 33836052; PMCID: PMC8495919.

From Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, December 2021

This is a ∆KU70 disruption strain, generated with SpCas9 based on the CC125 strain.
Background strain CC-125 mt+
Nuclease SpCas9
Target gene KU70 Cre13.g607500
Target sequence GTCGTTTGAGAACACCACAA
Marker pAphVII (pPH360)

This strain was published in Sizova et al https://doi.org/10.1093/g3journal/jkab114.
Overview of all strains from the Hegemann lab http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Sizova I, Kelterborn S, Verbenko V, Kateriya S, Hegemann P. Chlamydomonas POLQ is necessary for CRISPR/Cas9-mediated gene targeting. G3 (Bethesda). 2021 Apr 9;11(7):jkab114. doi: 10.1093/g3journal/jkab114. Epub ahead of print. PMID: 33836052; PMCID: PMC8495919.

From Setsuka Wakoa, Niyogi lab, University of California-Berkeley, January 2022

Insertion of zeocin resistance at Chr17, Cre17.g741300 and back-crossed 5 times.


Ledford HK, Chin BL, Niyogi KK. Acclimation to singlet oxygen stress in Chlamydomonas reinhardtii. Eukaryot Cell. 2007 Jun;6(6):919-30. doi: 10.1128/EC.00207-06. Epub 2007 Apr 13. PMID: 17435007; PMCID: PMC1951523.

Wakao S, Chin BL, Ledford HK, Dent RM, Casero D, Pellegrini M, Merchant SS, Niyogi KK. Phosphoprotein SAK1 is a regulator of acclimation to singlet oxygen in Chlamydomonas reinhardtii. Elife. 2014 May 23;3:e02286. doi: 10.7554/eLife.02286. PMID: 24859755; PMCID: PMC4067076.

From Antonia Schad, University of Leipzig, January 2022

This strain was obtained from a conventional crossing using two mutants: LMJ.SG0182.017965 (deficient in the gene for glycolate dehydrogenase) and CC-2702 cia5 (deficient in carbon concentrating mechanisms). Prior to this, both mutant strains were crossed with wild type strains to improve fitness: LMJ.SG0182.017965 x SAG 11-32b and CC-2702 cia5 x CC-410. 

D4cia5/GYD is a double mutant deficient in the genes for cia5/CCM1 and GYD1. Cia5 has previously been identified as master regulator of the carbon concentrating mechanism in Chlamydomonas (Fukuzawa et al, 2001; Xiang et al, 2001). GYD1 is the glycolate dehydrogenase that converts glycolate from photorespiration into glyoxylate. The strain requires elevated CO2 for growth on minimal medium due to its photorespiratory phenotype. It grows well on acetate medium. Since it contains a paromomycin resistance cassette, it can also be cultured on medium with antibiotic (Zhang et al., 2014).


Schad A, Rössler S, Nagel R, Wagner H, Wilhelm C. Crossing and selection of Chlamydomonas reinhardtii strains for biotechnological glycolate production. Appl Microbiol Biotechnol. 2022 May 5. doi: 10.1007/s00253-022-11933-y. Epub ahead of print. PMID: 35511277.


  • Locus:
  • CIA5 [CCM1], GYD1
  • Chromosome:
  • 2, 6

From Antonia Schad, University of Leipzig, January 2022

This strain was obtained from a conventional crossing using two mutants: LMJ.SG0182.017965 (deficient in the gene for glycolate dehydrogenase) and CC-2702 cia5 (deficient in carbon concentrating mechanisms). Prior to this, both mutant strains were crossed with wild type strains to improve fitness: LMJ.SG0182.017965 x SAG 11-32b and CC-2702 cia5 x CC-410. 

D5cia5/GYD is a double mutant deficient in the genes for cia5/CCM1 and GYD1. Cia5 has previously been identified as master regulator of the carbon concentrating mechanism in Chlamydomonas (Fukuzawa et al, 2001; Xiang et al, 2001). GYD1 is the glycolate dehydrogenase that converts glycolate from photorespiration into glyoxylate. The strain requires elevated CO2 for growth on minimal medium due to its photorespiratory phenotype. It grows well on acetate medium. Since it contains a paromomycin resistance cassette, it can also be cultured on medium with antibiotic (Zhang et al., 2014). 


Schad A, Rössler S, Nagel R, Wagner H, Wilhelm C. Crossing and selection of Chlamydomonas reinhardtii strains for biotechnological glycolate production. Appl Microbiol Biotechnol. 2022 May 5. doi: 10.1007/s00253-022-11933-y. Epub ahead of print. PMID: 35511277.


  • Locus:
  • CIA5 [CCM1], GYD1
  • Chromosome:
  • 2, 6

From Jim Moroney, Louisiana State University, January 2022

RNAi strain with reduced expression of two mitochondrial carbonic anhydrases, CAH4 and CAH5. 


Rai AK, Chen T, Moroney JV. Mitochondrial carbonic anhydrases are needed for optimal photosynthesis at low CO2 levels in Chlamydomonas. Plant Physiol. 2021 Nov 3;187(3):1387-1398. doi: 10.1093/plphys/kiab351. PMID: 34618049; PMCID: PMC8566214.


  • Locus:
  • CAH4, CAH5
  • Chromosome:
  • 5, 5

From Jim Moroney, Louisiana State University, January 2022

RNAi strain with reduced expression of two mitochondrial carbonic anhydrases, CAH4 and CAH5. 


Rai AK, Chen T, Moroney JV. Mitochondrial carbonic anhydrases are needed for optimal photosynthesis at low CO2 levels in Chlamydomonas. Plant Physiol. 2021 Nov 3;187(3):1387-1398. doi: 10.1093/plphys/kiab351. PMID: 34618049; PMCID: PMC8566214.


  • Locus:
  • CAH4, CAH5
  • Chromosome:
  • 5, 5

From Jim Moroney, Louisiana State University, January 2022

RNAi strain with reduced expression of two mitochondrial carbonic anhydrases, CAH4 and CAH5. 


Rai AK, Chen T, Moroney JV. Mitochondrial carbonic anhydrases are needed for optimal photosynthesis at low CO2 levels in Chlamydomonas. Plant Physiol. 2021 Nov 3;187(3):1387-1398. doi: 10.1093/plphys/kiab351. PMID: 34618049; PMCID: PMC8566214.


  • Locus:
  • CAH4, CAH5
  • Chromosome:
  • 5, 5

From Jim Moroney, Louisiana State University, January 2022

RNAi strain with reduced expression of three BST genes in Chlamydomonas, BST1, BST2 and BST3. BST1, BST2 and BST3 encode thylakoid membrane proteins thought to transport HCO3- across the thylakoid membrane. 


Mukherjee A, Lau CS, Walker CE, Rai AK, Prejean CI, Yates G, Emrich-Mills T, Lemoine SG, Vinyard DJ, Mackinder LCM, Moroney JV. Thylakoid localized bestrophin-like proteins are essential for the CO2 concentrating mechanism of Chlamydomonas reinhardtii. Proc Natl Acad Sci U S A. 2019 Aug 20;116(34):16915-16920. doi: 10.1073/pnas.1909706116. Epub 2019 Aug 7. PMID: 31391312; PMCID: PMC6708349.

From Jim Moroney, Louisiana State University, January 2022

RNAi strain with reduced expression of three BST genes in Chlamydomonas, BST1, BST2 and BST3. BST1, BST2 and BST3 encode thylakoid membrane proteins thought to transport HCO3- across the thylakoid membrane. 


Mukherjee A, Lau CS, Walker CE, Rai AK, Prejean CI, Yates G, Emrich-Mills T, Lemoine SG, Vinyard DJ, Mackinder LCM, Moroney JV. Thylakoid localized bestrophin-like proteins are essential for the CO2 concentrating mechanism of Chlamydomonas reinhardtii. Proc Natl Acad Sci U S A. 2019 Aug 20;116(34):16915-16920. doi: 10.1073/pnas.1909706116. Epub 2019 Aug 7. PMID: 31391312; PMCID: PMC6708349.

From Jim Moroney, Louisiana State University, January 2022

Cia6 is an insertional mutant that grows well on high CO2 but poorly under low CO2. The Para-R insert is in a gene that aligns with methyltransferases. The pyrenoid is also defective in this strain. 


Ma Y, Pollock SV, Xiao Y, Cunnusamy K, Moroney JV. Identification of a novel gene, CIA6, required for normal pyrenoid formation in Chlamydomonas reinhardtii. Plant Physiol. 2011 Jun;156(2):884-96. doi: 10.1104/pp.111.173922. Epub 2011 Apr 28. PMID: 21527423; PMCID: PMC3177283.


  • Locus:
  • CIA6
  • Chromosome:
  • 10