139 results found matching strain_source: Hegemann

Deposited by Yousef Yari Kamrani and Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, July 2023

This is a FixL-like PAS domain protein disruption strain, generated with CRISPR/Cas9.

Background strain: ROC75-Luc+ (from Takuya Matsuo, see Niwa et al. 2013 for details)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
Target gene: Cre13.g587550   
Target sequence:TCGGCTAAGGACAACGATGA TGG (Exon 1)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Darius Rauch, Peter Hegemann lab, Humboldt University of Berlin, May 2024.

This is an aCRY disruption strain, generated with CRISPR/Cas9.

Background strain: SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: pCRY, Cre06.g295200
Target sequence: GCGACATGCTGTATGAGCCG (Exon2)

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Simon Kelterborn and Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, February 2018

This is a chlamyopsin-1/2 (COP1/2) disruption strain, generated with CRISPR/Cas9.

Background strain              CC-125
Nuclease                                (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                    pAphVII (pPH360)
Target gene                           COP1/2, Cre01.g002500
Target sequence                  ATGGACTTCAAGAGCATCAGCGG (Exon 1)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of photoreceptor genes via zinc-finger nucleases and CRISPR/Cas9 in Chlamydomonas reinhardtii. Plant Cell 29, Issue 10

Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, February 2018 and Wenshuang Li, Maria Mittag lab, Friedrich Schiller University-Jena.

This is a aCRY disruption strain, generated with CRISPR/Cas9.

Note: Immunoblotting with aCRY antibody indicated small residual levels of aCRY protein.

Background strain              SAG 73.72 (= CC-3348)
Nuclease                                (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                    pAphVIII (pPH075)
Target gene                           aCRY, Cre06.g278251
Target sequence                  GCTGTGTTTTGAGCACGACACGG (Exon 5)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of photoreceptor genes via zinc-finger nucleases and CRISPR/Cas9 in Chlamydomonas reinhardtii. Plant Cell 29, Issue 10

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.

This is a Rad51C disruption strain, generated with SpCas9 based on the CC-125 strain. Knock-out generated using CRISPR/Cas9 and FLAG sequence CGCCCACGCtAATTaGCGTGGGCGcgtga to disrupt the gene of interest. It contains FLAG sequence + an unidentified DNA sequence inserted at the disruption site.

Background strain: CC-125 mt+
Nuclease: SpCas9
Target gene: Rad51C, Cre02.g102500
Target sequence: TCTCGCCACTGGTTTCGGCA
Marker: pAphVII (pPH360) 

This strain was not published. Please contact irinasiz@yahoo.com before using it.


  • Locus:
  • Rad51C, Cre02.g102500
  • Chromosome:
  • 2

From Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, December 2021

This is a POLQ disruption strain, generated with SpCas9 based on the CC125 strain.

Background strain: CC-125 mt+
Nuclease: SpCas9
Target gene: POLQ Cre16.g664300
Target sequence: GCCGCGCCATCCACATTGCT
Marker: pAphVII (pPH360)

This strain was published in Sizova et al https://doi.org/10.1093/g3journal/jkab114.
Overview of all strains from the Hegemann lab http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Sizova I, Kelterborn S, Verbenko V, Kateriya S, Hegemann P. Chlamydomonas POLQ is necessary for CRISPR/Cas9-mediated gene targeting. G3 (Bethesda). 2021 Apr 9;11(7):jkab114. doi: 10.1093/g3journal/jkab114. Epub ahead of print. PMID: 33836052; PMCID: PMC8495919.

From Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, December 2021

This is a KU80 disruption strain, generated with SpCas9 based on the CC125 strain.

Background strain: CC-125 mt+
Nuclease: SpCas9
Target gene: KU80 Cre10.g423800
Target sequence: CTCAGTGCCGTACAGCACCA
Marker: pAphVII (pPH360)

This strain was published in Sizova et al https://doi.org/10.1093/g3journal/jkab114.
Overview of all strains from the Hegemann lab http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Sizova I, Kelterborn S, Verbenko V, Kateriya S, Hegemann P. Chlamydomonas POLQ is necessary for CRISPR/Cas9-mediated gene targeting. G3 (Bethesda). 2021 Apr 9;11(7):jkab114. doi: 10.1093/g3journal/jkab114. Epub ahead of print. PMID: 33836052; PMCID: PMC8495919.

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, May 2021

This is a ChR2 disruption strain, generated with CRISPR/Cas9. 

Background strain: SAG 11-32b mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: ChR2, Cre02.g085257
Target sequence: AGTGGTTGCGTTACGCCGAG

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.


  • Locus:
  • ChR2
  • Chromosome:
  • 2

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, May 2021

This is a pCry disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
Target gene: pCry, Cre06.g295200
Target sequence: GACCTAGAGTGTGATGCGCT

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.


  • Locus:
  • pCry
  • Chromosome:
  • 6

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, September 2020

This is a aCry disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: aCry, Cre06.g278251
Target sequence: GAGCTCTGCTGGAGGAAATG

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, September 2020

This strain was transformed with a gene targeting selection (GTS) cassette that can be used as a reporter for successful gene targeting events and to establish and select for efficient ChR1- and ChR2 zinc-finger nucleases.

Background strain: CC-3403 mt-
Plasmid:: P-HSP70_P-RBCS2_I-RBCS2-YFP-2A-
APHVIII:ZFT(ChR1+2)_T-RBCS

This strain was published in Greiner et al 2017.

Overview of all strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019

This is a ChR2 disruption strain, generated with CRISPR/Cas9. 

Background strain: SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: ChR2, Cre02.g085257
Target sequence: AGTGGTTGCGTTACGCCGAG TGG (exon 6)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.


  • Locus:
  • ChR2
  • Chromosome:
  • 2

Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a 2-LOG disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a COP11 (HKR7) disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
Target gene: COP11 (HKR7), Cre17.g733150
Target sequence: GGTCTGTCATCGCAATGACGGGG (Exon 3)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

From Andre Greiner, Hegemann lab, Humboldt University-Berlin, November 2015


Trippens J, Greiner A, Schellwat J, Neukam M, Rottmann T, Lu Y, Kateriya S, Hegemann P, Kreimer G (2012) Phototropin influence on eyespot development and regulation of phototactic behavior in Chlamydomonas reinhardtii. Plant Cell 24:4687-702

From Andre Greiner, Hegemann lab, Humboldt University-Berlin, November 2015

Andre Greiner suggests that this strain be re-selected on Zeocin before analysis.


Trippens J, Greiner A, Schellwat J, Neukam M, Rottmann T, Lu Y, Kateriya S, Hegemann P, Kreimer G (2012) Phototropin influence on eyespot development and regulation of phototactic behavior in Chlamydomonas reinhardtii. Plant Cell 24:4687-702

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023

This is a strain with a point mutation E123T in ChR2 and disrupted ChR1. The strain was generated with CRISPR/Cas9.

Background strain: CC-125 mt+ 
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360); pAPHVIII (pPH75)
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); AGTGGTTGCGTTACGCCGAG (ChR2)

Overview of all CRISPR/Cas9 strains from the Hegemann lab

http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is a published strain. Please cite it accordingly: Baidukova O., Oppermann J., Kelterborn S., Fernandez Lahore R.G., Schumacher D., Evers H., Kamrani Y.Y. and Hegemann P. (2022) Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat. Commun. 13, 7253. https://doi.org/10.1038/s41467-022-35018-6


Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023

This is a strain with a point mutation E90R in ChR2 and disrupted ChR1. The strain was generated with CRISPR/Cas9.

Background strain: CC-125 mt+ 
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360); pAPHVIII (pPH75)
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); CTATGTGTGCGCTATCGAGG (ChR2)

Overview of all CRISPR/Cas9 strains from the Hegemann lab

http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023

This is a strain with a point mutation E90R in ChR2 and disrupted ChR1. The strain was generated with CRISPR/Cas9.

Background strain: CC-125 mt+ 
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360); pAPHVIII (pPH75)
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); CTATGTGTGCGCTATCGAGG (ChR2)

Overview of all CRISPR/Cas9 strains from the Hegemann lab

http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is a published strain. Please cite it accordingly: Baidukova O., Oppermann J., Kelterborn S., Fernandez Lahore R.G., Schumacher D., Evers H., Kamrani Y.Y. and Hegemann P. (2022) Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat. Commun. 13, 7253. https://doi.org/10.1038/s41467-022-35018-6


Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023

This is a strain with a disrupted COP6 (HKR2). The strain was generated with CRISPR/Cas9.

Background strain: SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
Target gene: COP6 (HKR2), Cre11.g467678
Target sequence: GTTGTCTTCGAACAAGAGCG

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab

http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, February 2018

This is a MAT3 disruption strain, generated with CRISPR/Cas9. MAT3 shows strong homology to the animal retinoblastoma cancer gene.

Background strain              CC-125
Nuclease                                (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                    pAphVII (pPH360)
Target gene                           MAT3, Cre06.g255450
Target sequence                  GCTGAAGGAGAACTCGGAAACGG (Exon 3)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of photoreceptor genes via zinc-finger nucleases and CRISPR/Cas9 in Chlamydomonas reinhardtii. Plant Cell 29, Issue 10

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, February 2018

This is a phototropin disruption strain, generated with CRISPR/Cas9.

Background strain              CC-125
Nuclease                                (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                    pAphVII (pPH360)
Target gene                           Phototropin, PHOT, Cre03.g199000
Target sequence                  GCGCATCCTCAACTACACCAAGG (Exon 6)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of photoreceptor genes via zinc-finger nucleases and CRISPR/Cas9 in Chlamydomonas reinhardtii. Plant Cell 29, Issue 10

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.

This is a Rad51C disruption strain, generated with SpCas9 based on the CC-5887 D5-1 [PH55] strain containing the gene targeting selection construct ble:yfp:mut-aphVIII. Knock-out generated using CRISPR/Cas9 and FLAG sequence CGCCCACGCTAATTAGCGTGGGCGCGTGAG to disrupt the gene of interest. It contains the 55 bp insert including FLAG sequence + the 25 bp fragment of the chromosomal DNA at the disruption site.

Background strain: CC-5887 D5-1 
Nuclease: SpCas9
Target gene: Rad51C, Cre02.g102500
Target sequence: TCTCGCCACTGGTTTCGGCA
Marker: pAphVII (pPH360) 

This strain was not published. Please contact irinasiz@yahoo.com before using it.


  • Locus:
  • Rad51C, Cre02.g102500
  • Chromosome:
  • 2

Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University of Berlin,
April 2022

This strain was generated by insertion of the gene targeting selection (GTS) construct ble:yfp:mut-aphVIII containing SpCas9 target sites for the human EMX1 homeobox protein gene (Ran et al., 2015) and for ChR1 specific zinc finger nuclease (ZFN) into CC-3403 strain.

Background strain: CC-3403
Target genes: inactivated gene of the paromomycin resistance mut-aphVIII
ChR1 Cre14.g611300

Target sequences: SpCas9: ACTCCCTGGCCAGGCTTTGGGGAGGCC
ChR1 ZFN: CCCTCCGCCATGAGCGCCGGCGGCCG

This strain was published in Greiner et al 2017.

Overview of all strains from the Hegemann lab http://www.chlamy.de/strains


Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P. Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell. 2017 Oct;29(10):2498-2518. doi: 10.1105/tpc.17.00659. Epub 2017 Oct 4. PMID: 28978758; PMCID: PMC5774583.

Deposited by Darius Rauch, Peter Hegemann lab, Humboldt University-Berlin, April 2022

This is a pCRY (CPH1) disruption strain, generated with CRISPR/Cas9. 

Background strain: ROC40-LUC+ (from Takuya Matsuo, see Niwa et al. 2013)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
Target gene: pCRY (CPH1), Cre06.g295200
Target sequence: GACCTAGAGTGTGATGCGCT (Exon7)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, May 2021

This is a ChR1ChR2 disruption strain, generated with CRISPR/Cas9. 

Background strain: SAG 11-32b mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
pAPHVIII (pPH75)
Target gene: ChR1, Cre14.g611300
ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG
AGTGGTTGCGTTACGCCGAG

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.


  • Locus:
  • ChR1, ChR2
  • Chromosome:
  • 14, 2

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, May 2021

This is a ChR1 disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-124 mt-
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Target gene: ChR1, Cre14.g611300
Target sequence: TGTGGCTTCGTTACGCGGAG

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.


  • Locus:
  • ChR1
  • Chromosome:
  • 14

Deposited by Simon Kelterborn and Philipp Sachse, Peter Hegemann lab, Humboldt University of Berlin, November 2020

This is a pCRY disruption in a ROC15-Luc+ reporter strain, generated with CRISPR/Cas9. Clone C64

Background strain: ROC15-Luc+ (from Takuya Matsuo, see Niwa et al. 2013 for details)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
Target gene: pCRY, (Cre06.g295200)
Target sequence: GCGACATGCTGTATGAGCCG TGG (exon 2)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Simon Kelterborn and Philipp Sachse, Peter Hegemann lab, Humboldt University of Berlin, November 2020

This is a pCRY disruption in a ROC15-Luc+ reporter strain, generated with CRISPR/Cas9. Clone D5

Background strain: ROC15-Luc+ (from Takuya Matsuo, see Niwa et al. 2013 for details)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
Target gene: pCRY, (Cre06.g295200)
Target sequence: GCGACATGCTGTATGAGCCG TGG (exon 2)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, November 2019

This is a ChR1 ChR2 disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
pAphVII (pPH360)
Target gene: ChR1, Cre14.g611300
ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG TGG (ChR1, exon 5)
CTATGTGTGCGCTATCGAGG TGG (ChR2, exon 4)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.


  • Locus:
  • ChR1, ChR2
  • Chromosome:
  • 14, 2