Search Results for
CC-5636 RR6 [PH005]
$20.00
$20.00
From Heide Evers, Peter Hegemann lab, Humboldt University-Berlin, July 2020
CC-5637 RR6-∆ChR1#1 [PH006]
$20.00
$20.00
From Heide Evers, Peter Hegemann lab, Humboldt University-Berlin, July 2020
CC-5638 R2-∆ChR2-D6 [PH009]
$20.00
$20.00
From Heide Evers, Peter Hegemann lab, Humboldt University-Berlin, July 2020
CC-5639 RR6-∆ChR1+2 [PH012]
$20.00
$20.00
From Heide Evers, Peter Hegemann lab, Humboldt University-Berlin, July 2020
CC-5640 ∆pCry-D7 [PH230]
$20.00
$20.00
From Heide Evers, Peter Hegemann lab, Humboldt University-Berlin, July 2020
From Heide Evers, Peter Hegemann lab, Humboldt University-Berlin, July 2020
From Heide Evers, Peter Hegemann lab, Humboldt University-Berlin, July 2020
From Heide Evers, Peter Hegemann lab, Humboldt University-Berlin, July 2020
CC-5644 ∆aCRY-C12 [PH235]
$20.00
$20.00
From Heide Evers, Peter Hegemann lab, Humboldt University-Berlin, July 2020
From Heide Evers, Peter Hegemann lab, Humboldt University-Berlin, July 2020
CC-5615 ∆COP1-F6 mt+ [PH239]
$20.00
$20.00
From Heide Evers, Hegemann lab, Humboldt University-Berlin, January 2020
Strain PH239 ∆COP1-F6 includes the 581 bp insert inside COP1
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, November 2019
This is a ChR1 ChR2 disruption strain, generated with CRISPR/Cas9.Â
Background strain CC-125 mt+
Nuclease (Sp)Cas9 as ribonucleoprotein (RNP)
Marker pAPHVIII (pPH75)
pAphVII (pPH360)
Target gene ChR1, Cre14.g611300
ChR2, Cre02.g085257
Target sequence TGTGGCTTCGTTACGCGGAG TGG (ChR1, exon 5)
CTATGTGTGCGCTATCGAGG TGG (ChR2, exon 4)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, November 2019
This is a ChR1 ChR2 disruption strain, generated with CRISPR/Cas9.Â
Background strain CC-125 mt+
Nuclease (Sp)Cas9 as ribonucleoprotein (RNP)
Marker pAPHVIII (pPH75)
pAphVII (pPH360)
Target gene ChR1, Cre14.g611300
ChR2, Cre02.g085257
Target sequence TGTGGCTTCGTTACGCGGAG TGG (ChR1, exon 5)
CTATGTGTGCGCTATCGAGG TGG (ChR2, exon 4)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, November 2019
This is a ChR1 ChR2 disruption strain, generated with CRISPR/Cas9 and Zinc-finger nuclease.Â
Background strain CC-125 mt+
Nuclease (Sp)Cas9 as ribonucleoprotein (RNP)
Zinc-finger nuclease (ZFN)
Marker pAPHVIII (pPH75)
pAphVII (pPH360)
Target gene ChR1, Cre14.g611300
ChR2, Cre02.g085257
Target sequence TGTGGCTTCGTTACGCGGAG TGG (ChR1, exon 5)
CTATGTGTGCGCTATCGAGG TGG (ChR2, exon 4)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, November 2019
This is a ChR1 ChR2 disruption strain, generated with CRISPR/Cas9 and Zinc-finger nuclease.Â
Background strain CC-125 mt+
Nuclease (Sp)Cas9 as ribonucleoprotein (RNP)
Zinc-finger nuclease (ZFN)
Marker pAPHVIII (pPH75)
pAphVII (pPH360)
Target gene ChR1, Cre14.g611300
ChR2, Cre02.g085257
Target sequence TGTGGCTTCGTTACGCGGAG TGG (ChR1, exon 5)
CTATGTGTGCGCTATCGAGG TGG (ChR2, exon 4)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019
This is a ChR2 disruption strain, generated with CRISPR/Cas9.Â
Background strain CC-3403 mt-
Nuclease (Sp)Cas9 as ribonucleoprotein (RNP)
Marker pARG (pHR11)
Target gene ChR2, Cre02.g085257
Target sequence AGTGGTTGCGTTACGCCGAG TGG (exon 6)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019
This is a ChR2 disruption strain, generated with CRISPR/Cas9.Â
Background strain CC-3403 mt-
Nuclease (Sp)Cas9 as ribonucleoprotein (RNP)
Marker pARG (pHR11)
Target gene ChR2, Cre02.g085257
Target sequence AGTGGTTGCGTTACGCCGAG TGG (exon 6)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
CC-5550 ∆ChR1-H6 mt+ [PH160]
$20.00
$20.00
Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019
This is a ChR1 disruption strain, generated with CRISPR/Cas9.Â
Background strain SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease (Sp)Cas9 as ribonucleoprotein (RNP)
Marker pAPHVIII (pPH75)
Target gene ChR1, Cre14.g611300
Target sequence TGTGGCTTCGTTACGCGGAG TGG (exon 5)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019
This is a 4-IPT disruption strain, generated with CRISPR/Cas9.Â
Background strain CC-125 mt+
Nuclease (Sp)Cas9 as ribonucleoprotein (RNP)
Marker pAPHVIII (pPH75)
Target gene 4-IPT, Cre17.g717350
Target sequence GGTGATTGTGACGGGGCCCA CGG (Exon 1)
This strain was generated in a collaboration with Prof. Thomas Roitsch.
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
CC-5551 ∆ChR1-F1 mt+ [PH163]
$20.00
$20.00
Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019
This is a ChR1 disruption strain, generated with CRISPR/Cas9.Â
Background strain SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease (Sp)Cas9 as ribonucleoprotein (RNP)
Marker pAPHVIII (pPH75)
Target gene ChR1, Cre14.g611300
Target sequence TGTGGCTTCGTTACGCGGAG TGG (exon 5)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019
This is a 4-IPT disruption strain, generated with CRISPR/Cas9.Â
Background strain CC-125 mt+
Nuclease (Sp)Cas9 as ribonucleoprotein (RNP)
Marker pAPHVIII (pPH75)
Target gene 4-IPT, Cre17.g717350
Target sequence GGTGATTGTGACGGGGCCCA CGG (Exon 1)
This strain was generated in a collaboration with Prof. Thomas Roitsch.
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
CC-5552 ∆ChR2-H9 mt+ [PH165]
$20.00
$20.00
Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019
This is a ChR2 disruption strain, generated with CRISPR/Cas9.Â
Background strain SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease (Sp)Cas9 as ribonucleoprotein (RNP)
Marker pAPHVIII (pPH75)
Target gene ChR2, Cre02.g085257
Target sequence AGTGGTTGCGTTACGCCGAG TGG (exon 6)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019
This is a CiliK (GCLK1) disruption strain, generated with CRISPR/Cas9.Â
Background strain SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease (Sp)Cas9 as ribonucleoprotein (RNP)
Marker pAPHVIII (pPH75)
Target gene CiliK/GCLK1, Cre02.g104450
Target sequence CCGGGATTCGAAGCGACGGA CGG (exon 1)
This strain was generated in a collaboration with Prof. William Snell.
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, November 2019
This is a ChR1 ChR2 disruption strain, generated with CRISPR/Cas9.Â
Background strain CC-125 mt+
Nuclease (Sp)Cas9 as ribonucleoprotein (RNP)
Marker pAPHVIII (pPH75)
pAphVII (pPH360)
Target gene ChR1, Cre14.g611300
ChR2, Cre02.g085257
Target sequence TGTGGCTTCGTTACGCGGAG TGG (ChR1, exon 5)
GCTCGCGCCCAACGGCACTC AGG (ChR2, exon 1)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
CC-5543 ∆CiliK-D1 mt+ [PH170
$20.00
$20.00
Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019
This is a CiliK (GCLK1) disruption strain, generated with CRISPR/Cas9.Â
Background strain SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease (Sp)Cas9 as ribonucleoprotein (RNP)
Marker pAPHVIII (pPH75)
Target gene CiliK/GCLK1, Cre02.g104450
Target sequence CCGGGATTCGAAGCGACGGA CGG (exon 1)
This strain was generated in a collaboration with Prof. William Snell.
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019
This is a CAV2 disruption strain, generated with CRISPR/Cas9.Â
Background strain CC-5075 mt+ (sequence verified clone of CC-125)
Nuclease (Sp)Cas9 as ribonucleoprotein (RNP)
Marker pAPHVIII (pPH75)
Target gene CAV2, Cre16.g665050
Target sequence GGCGTACCGTCAATCAGCAT GGG (exon 5)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019
This is a CAV2 disruption strain, generated with CRISPR/Cas9.Â
Background strain CC-5075 mt+ (sequence verified clone of CC-125)
Nuclease (Sp)Cas9 as ribonucleoprotein (RNP)
Marker pAPHVIII (pPH75)
Target gene CAV2, Cre16.g665050
Target sequence GGCGTACCGTCAATCAGCAT GGG (exon 5)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019
This is a ChR1 disruption strain, generated with CRISPR/Cas9.Â
Background strain CC-3403 mt-
Nuclease (Sp)Cas9 as ribonucleoprotein (RNP)
Marker pARG (pHR11)
Target gene ChR1, Cre14.g611300
Target sequence TGTGGCTTCGTTACGCGGAG TGG (exon 5)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019
This is a ChR1 disruption strain, generated with CRISPR/Cas9.Â
Background strain CC-3403 mt-
Nuclease (Sp)Cas9 as ribonucleoprotein (RNP)
Marker pARG (pHR11)
Target gene ChR1, Cre14.g611300
Target sequence TGTGGCTTCGTTACGCGGAG TGG (exon 5)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
CC-5499 ∆ChR1 ∆ChR2 [PH128]
$20.00
$20.00
From Heide Evers, Peter Hegemann lab, Humboldt University-Berlin, March 2019
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, March 2019
This is a ChR1 /ChR2 disruption strain, generated with CRISPR/Cas9.
Background strain CC-125
Nuclease (Sp)Cas9 as ribonucleoprotein (RNP)
Marker pAPHVIII (p114), pAPHVII (p360)
Target gene ChR1 (COP3), Cre14.g611300
ChR2 (COP4), Cre02.g085257
Target sequence ChR1: TGTGGCTTCGTTACGCGGAGTGG (Exon5)
ChR2: GCTCGCGCCCAACGGCACTCAGG (Exon1)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact us if you want to use it.
- 1
- 2
- 3
- 4
- Next Page»