Strains

From Dr. Krishna Niyogi, University of California-Berkeley, February 2020

The 2pac mutant CAL028_03_28 was transformed with mutant RBD1 cDNA under control of PSAD promoter and terminator. Constitutive overexpression of ΔTP mutant version of RBD1

Maintain on TAP plates containing 25 μg/mL hygromycin and/or paromomycin.

Garc’a-Cerd‡n JG, Furst AL, McDonald KL, Schünemann D, Francis MB, Niyogi KK (2019) A thylakoid membrane-bound and redox-active rubredoxin (RBD1) functions in de novo assembly and repair of photosystem II. Proc Natl Acad Sci U S A. 116:16631-16640

  • Locus:
  • RBD1
  • Chromosome:
  • 7

From Rosario Barbieri, Patrice P. Hamel lab, The Ohio State University, February 2020

Genotype: mt-; arg7-8; APHVII

This strain was created by mutagenesis of 4C- with a cassette containing the APHVII transgene from pHyg3. This strain in hygromycin resistant.

Barbieri MR, Larosa V, Nouet C, Subrahmanian N, Remacle C, Hamel PP. A forward genetic screen identifies mutants deficient for mitochondrial complex I assembly in Chlamydomonas reinhardtii. Genetics. 2011 Jun;188(2):349-58. doi: 10.1534/genetics.111.128827. Epub 2011 Apr 5. PubMed PMID: 21467570; PubMed Central PMCID: PMC3122308.

From Rosario Barbieri, Patrice P. Hamel lab, The Ohio State University, February 2020

Genotype: mt-; arg7-8; APHVII

This strain was created by mutagenesis of 4C- with a cassette containing the APHVII transgene from pHyg3.

It should be maintained in low-medium light conditions (max. 50 µmol.m-2.s-1) and the media should contain arginine. Do not maintain in the dark as it is respiratory-deficient. This strain in hygromycin resistant.

Barbieri MR, Larosa V, Nouet C, Subrahmanian N, Remacle C, Hamel PP. A forward genetic screen identifies mutants deficient for mitochondrial complex I assembly in Chlamydomonas reinhardtii. Genetics. 2011 Jun;188(2):349-58. doi: 10.1534/genetics.111.128827. Epub 2011 Apr 5. PubMed PMID: 21467570; PubMed Central PMCID: PMC3122308.

From Rosario Barbieri, Patrice P. Hamel lab, The Ohio State University, February 2020

Genotype: mt+; arg7-8; APHVIII

This strain was created by mutagenesis of 3A+ with a cassette containing the APHVII transgene from pSL18.

It should be maintained in low-medium light conditions (max. 50 µmol.m-2.s-1) and the media should contain arginine. Do not maintain in the dark as it is respiratory-deficient. This strain in paromomycin resistant.

Barbieri MR, Larosa V, Nouet C, Subrahmanian N, Remacle C, Hamel PP. A forward genetic screen identifies mutants deficient for mitochondrial complex I assembly in Chlamydomonas reinhardtii. Genetics. 2011 Jun;188(2):349-58. doi: 10.1534/genetics.111.128827. Epub 2011 Apr 5. PubMed PMID: 21467570; PubMed Central PMCID: PMC3122308.

From Rosario Barbieri, Patrice P. Hamel lab, The Ohio State University, February 2020

Genotype: mt+; arg7-8; APHVIII

This strain was created by mutagenesis of 3A+ with a cassette containing the APHVII transgene from pSL18.

It should be maintained in low-medium light conditions (max. 50 µmol.m-2.s-1) and the media should contain arginine. Do not maintain in the dark as it is respiratory-deficient. This strain in paromomycin resistant.

Barbieri MR, Larosa V, Nouet C, Subrahmanian N, Remacle C, Hamel PP. A forward genetic screen identifies mutants deficient for mitochondrial complex I assembly in Chlamydomonas reinhardtii. Genetics. 2011 Jun;188(2):349-58. doi: 10.1534/genetics.111.128827. Epub 2011 Apr 5. PubMed PMID: 21467570; PubMed Central PMCID: PMC3122308.

From Nitya Subrahmanian, Patrice P. Hamel lab, The Ohio State University, February 2020

Genotype: mt-; amc13

This strain is a genetic cross of amc13 (4C3) and CC-125.

This mitochondrial complex I-deficient strain should be maintained in low-medium light conditions (max. 50 µmol.m-2.s-1) and the media should contain arginine. Do not maintain in the dark as it is respiratory-deficient.

Subrahmanian N, Castonguay AD, Fatnes TA, Hamel PP. Chlamydomonas reinhardtii as a plant model system to study mitochondrial complex I dysfunction. Plant Direct. 2020 Feb 3;4(2):e00200. doi: 10.1002/pld3.200. eCollection 2020 Feb. PubMed PMID: 32025618; PubMed Central PMCID: PMC6996877.

From Nitya Subrahmanian, Patrice P. Hamel lab, The Ohio State University, February 2020

Genotype: mt+; amc1-2; APHVII

This mitochondrial complex I-deficient strain is a genetic cross of amc11(10G11) with a 137c mt+ strain (1′) from Dr. Claire Remacle (University of Liege) selected for arg+, hygromycin B resistant meiotic prorgeny. The APHVII transgene disrupts Cre16.g688900 in exon 2. It is hygromycin B resistant and an arginine prototroph.

Maintain in medium light conditions (max. 50 µmol.m-2.s-1). Do not maintain in the dark as it is respiratory-deficient.

Subrahmanian N, Castonguay AD, Remacle C, Hamel PP. Assembly of Mitochondrial Complex I Requires the Low-Complexity Protein AMC1 in Chlamydomonas reinhardtii. Genetics. 2020 Feb 19. pii: genetics.303029.2020. doi: 10.1534/genetics.120.303029. [Epub ahead of print] PubMed PMID: 32075865.

  • Locus:
  • AMC1
  • Chromosome:
  • 16

From Nitya Subrahmanian, Patrice P. Hamel lab, The Ohio State University, February 2020

Genotype: mt-; amc1-2; APHVII; arg9-2

This mitochondrial complex I-deficient strain is a genetic cross of amc11(70) with a complex I proficient derivative of arg9-2 (Hamel strain 141) to select for arg-, hygromycin B resistant meiotic progeny. The APHVII transgene disrupts Cre16.g688900 in exon 2.

Maintain in medium light conditions (max. 50 µmol.m-2.s-1) and not in the dark as it is respiratory-deficient. Media should contain arginine.

Subrahmanian N, Castonguay AD, Remacle C, Hamel PP. Assembly of Mitochondrial Complex I Requires the Low-Complexity Protein AMC1 in Chlamydomonas reinhardtii. Genetics. 2020 Feb 19. pii: genetics.303029.2020. doi: 10.1534/genetics.120.303029. [Epub ahead of print] PubMed PMID: 32075865.

  • Locus:
  • AMC1
  • Chromosome:
  • 16

From Nitya Subrahmanian, Patrice P. Hamel lab, The Ohio State University, February 2020

Genotype: mt+; amc1-2; APHVII; arg9-2

This mitochondrial complex I-deficient strain is a genetic cross of amc11(70) with a complex I proficient derivative of arg9-2 (Hamel strain 141) to select for arg-, hygromycin B resistant meiotic progeny. The APHVII transgene disrupts Cre16.g688900 in exon 2.

Maintain in medium light conditions (max. 50 µmol.m-2.s-1) and not in the dark as it is respiratory-deficient. Media should contain arginine.

Subrahmanian N, Castonguay AD, Remacle C, Hamel PP. Assembly of Mitochondrial Complex I Requires the Low-Complexity Protein AMC1 in Chlamydomonas reinhardtii. Genetics. 2020 Feb 19. pii: genetics.303029.2020. doi: 10.1534/genetics.120.303029. [Epub ahead of print] PubMed PMID: 32075865.

  • Locus:
  • AMC1
  • Chromosome:
  • 16

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, September 2020

This strain was transformed with a gene targeting selection (GTS) cassette that can be used as a reporter for successful gene targeting events and to establish and select for efficient ChR1- and ChR2 zinc-finger nucleases.

Background strain: CC-3403 mt-
Plasmid:: P-HSP70_P-RBCS2_I-RBCS2-YFP-2A-
APHVIII:ZFT(ChR1+2)_T-RBCS

This strain was published in Greiner et al 2017.

Overview of all strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, September 2020

This is a ChR1 disruption strain, generated with ChR1-ZFNs based on the RR6 selection strain.
Background strain: CC-5636 RR6 mt- [PH005]
Nuclease: ChR1-ZFNs
Target gene: ChR1, Cre14.g611300
Target sequence: ZFN-L: CCCTCCGCC
ZFN-R: GCCGGCGGC

This strain was published in Greiner et al 2017.

Overview of all strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, September 2020

This is a ChR2 disruption strain, generated with ChR2-ZFNs based on the R2 selection strain.

Background strain: R2
Nuclease: ChR2-ZFNs
Target gene: ChR2, Cre02.g085257
Target sequence: ZFN-L: CCACACCGTGCC
ZFN-R: CCGGTGTCGCCA

This strain was published in Greiner et al 2017.

Overview of all strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P. Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell. 2017 Oct;29(10):2498-2518. doi: 10.1105/tpc.17.00659. Epub 2017 Oct 4. PMID: 28978758; PMCID: PMC5774583.

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, September 2020

This is a ChR1-ChR2 disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-5637 RR6-∆ChR1 mt- [PH006]
Nuclease: ChR1-ZFN & ChR2-ZFN
Target gene: ChR1, Cre14.g611300
ChR2, Cre02.g085257
Target sequence: (ChR1) ZFN-L: CCCTCCGCC
ZFN-R: GCCGGCGGC

Target sequence: (ChR2) ZFN-L: CCACACCGTGCC
ZFN-R: CCGGTGTCGCCA

This strain was published in Greiner et al 2017.

Overview of all strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P. Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell. 2017 Oct;29(10):2498-2518. doi: 10.1105/tpc.17.00659. Epub 2017 Oct 4. PMID: 28978758; PMCID: PMC5774583.

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, September 2020

This is a pCry disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
Target gene: pCry, Cre06.g295200
Target sequence: GACCTAGAGTGTGATGCGCT

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, September 2020

This is a aCry pCry disruption strain, generated with CRISPR/Cas9. 

Background strain: SAG 73.72 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
pAPHVIII (pPH75)
Target gene: pCry, Cre06.g295200
aCry, Cre06.g278251
Target sequence: GACCTAGAGTGTGATGCGCT
GAGCTCTGCTGGAGGAAATG

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, September 2020

This is a aCry pCry disruption strain, generated with CRISPR/Cas9. 

Background strain: SAG 73.72 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
pAPHVIII (pPH75)
Target gene: pCry, Cre06.g295200
aCry, Cre06.g278251
Target sequence: GACCTAGAGTGTGATGCGCT
GAGCTCTGCTGGAGGAAATG

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, September 2020

This is a ChR2 disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-125 mt+
Nuclease: Zink finger (ZFN)
Marker: pAphVII (pPH360)
Target gene: ChR2, Cre02.g085257

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, September 2020

This is a aCry disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: aCry, Cre06.g278251
Target sequence: GAGCTCTGCTGGAGGAAATG

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, September 2020

This is a aCry pCry disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
pAPHVIII (pPH75)
Target gene: pCry, Cre06.g295200
aCry, Cre06.g278251
Target sequence: GACCTAGAGTGTGATGCGCT
GAGCTCTGCTGGAGGAAATG

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

From Moritz Meyer, Martin Jonikas lab, Princeton University, August 2020

This strain was created by transforming CMJ030 with pLM164 and is paromomycin resistant.

pLM164: pLM099-Cre06.g261750-Venus-3xFLAG

RBMP1 (Cre06.g261750) gDNA coding sequence plus 3672 bp upstream of the start codon was cloned into pLM099 by recombineering to produce a C-terminal CrVenus-3xFLAG tag.

https://www.biorxiv.org/content/10.1101/2020.08.16.252858v1.full

From Moritz Meyer, Martin Jonikas lab, Princeton University, August 2020

This strain was created by transforming CMJ030 with pLM155 and is paromomycin resistant.

pLM155: pLM099-Cre09.g416850-Venus-3xFLAG

RBMP2 (Cre09.g416850) coding sequence plus 2250 bp upstream of the start codon was cloned into pLM099 by recombineering to produce a C-terminal CrVenus-3xFLAG tag.

https://www.biorxiv.org/content/10.1101/2020.08.16.252858v1.full

From Moritz Meyer, Martin Jonikas lab, Princeton University, August 2020

This strain was created by transforming CMJ030 with pMJ503 and is paromomycin resistant.

pMJ503: pLM005-Cre14.g626700-Venus-3xFLAG-3xCtermSAGA2

FDX1 (Cre14.g626700) gDNA coding sequence, spanning the start codon to the triplet just before the stop codon, had been previously cloned in frame into pLM005 by Gibson assembly (as described in https://doi.org/10.1073/pnas.1522866113; CSI_FC1F06 = pLM005-Cre14.g626700-Venus-3xFLAG). That plasmid was then reengineered by restriction digestion and T4 ligation to add in-frame immediately after the 3xFLAG a synthetic fragment containing three copies of the sequence coding for the 15 C-terminal amino acids of SAGA2 (Cre 09.g394621), interspersed with a short flexible linker (GGGGGS).

From Moritz Meyer, Martin Jonikas lab, Princeton University, August 2020

This strain was created by transforming CMJ030 with pMJ504 and is paromomycin resistant.

pMJ504: pLM005-Cre12.g498550-Venus-3xFLAG

MPM1 (Cre12.g498550) gDNA coding sequence, spanning the start codon to the triplet just before the stop codon, was cloned in frame into pLM005 by Gibson assembly (as described in https://doi.org/10.1073/pnas.1522866113.

From Moritz Meyer, Martin Jonikas lab, Princeton University, August 2020

This strain was created by transforming CMJ030 with pMJ505 and is paromomycin resistant.

pMJ505: pLM005-Cre12.g498550-Venus-3xFLAG-3xCtermSAGA2

pMJ504, containing the gDNA of Cre12.g498550, was reengineered by restriction digestion and T4 ligation to add in-frame immediately after the 3xFLAG a synthetic fragment containing three copies of the sequence coding for the 15 C-terminal amino acids of SAGA2 (Cre 09.g394621), interspersed with a short flexible linker (GGGGGS).

From Moritz Meyer, Martin Jonikas lab, Princeton University, August 2020

This strain was created by transforming CMJ030 with pMJ506 and is paromomycin resistant.

pMJ506: pLM005-Cre17.g724300-Venus-3xFLAG-3xCtermSAGA2

PSAK (Cre17.g724300) gDNA coding sequence, spanning the start codon to the triplet just before the stop codon, had been previously cloned in frame into pLM005 by Gibson assembly (as described in https://doi.org/10.1073/pnas.1522866113; pMJ280 = pLM005-Cre17.g724300-Venus-3xFLAG). That plasmid was then reengineered by restriction digestion and T4 ligation to add in-frame immediately after the 3xFLAG a synthetic fragment containing three copies of the sequence coding for the 15 C-terminal amino acids of SAGA2 (Cre 09.g394621), interspersed with a short flexible linker (GGGGGS)

From Moritz Meyer, Martin Jonikas lab, Princeton University, August 2020

This strain was created by transforming CMJ030 with pMJ507 and is paromomycin resistant.

pMJ507: pLM005-Cre10.g430350-Venus-3xFLAG

Cre10.g430350 gDNA coding sequence, spanning the start codon to the triplet just before the stop codon, was cloned in frame into pLM005 by Gibson assembly (as described in https://doi.org/10.1073/pnas.1522866113).

From Moritz Meyer, Martin Jonikas lab, Princeton University, August 2020

This strain was created by transforming CMJ030 with pMJ508 and is paromomycin resistant.

pMJ508: pLM005-Cre10.g430350[W51A/R52A]-Venus-3xFLAG

Previously synthesized pMJ507 (CC-5652) was modified by side-directed mutagenesis. Triplet coding for Tryptophan in position 51 of the mature protein now codes for an Alanine. Triplet coding for Arginine in position 52 of the mature protein now codes for an Alanine.

From Moritz Meyer, Martin Jonikas lab, Princeton University, August 2020

This strain was created by transforming CMJ030 with pMJ509 and is paromomycin resistant.

pMJ509: pLM005-Cre10.g430350[W47A/R48A/W51A/R52A/W110A/R111A/W148A/R149A]-Venus-3xFLAG

Previously synthesized pMJ507 was modified by side-directed mutagenesis. All four triplet pairs coding for a Tryptophan-Arginine dipeptide were mutagenized to code for a double Alanine (W47A/R48A/W51A/R52A/W110A/R111A/W148A/R149A).

From Moritz Meyer, Martin Jonikas lab, Princeton University, August 2020

This strain was created by transforming CMJ030 with pLM154 and is paromomycin resistant.

pLM154: pLM099-Cre09.g394621-Venus-3xFLAG

SAGA2 (Cre09.g394621) coding sequence plus 2216 bp upstream of the start codon was cloned into pLM099 by recombineering to produce a C-terminal CrVenus-3xFLAG tag.

https://www.biorxiv.org/content/10.1101/2020.08.16.252858v1.full

From Dr. Vinzenz Bayro-Kaiser, Tel Aviv University-Israel, August 2020

Mutant allele: Cre02.g076250.t1.1:c.2044_2045delCCinsTT
Background: 1A+ (137c) obtained from Prof. Jean-David Rochaix
Origin: UV induced mutagenesis followed by 5 times backcrossing to the background strain and selection
Culture maintenance: TAP media, 25 °C, 100 uEm-2s-1

Bayro-Kaiser V, Nelson N (2016)Temperature-sensitive PSII: a novel approach for sustained photosynthetic hydrogen production. Photosynth Res. 130:113-121

Bayro-Kaiser V, Nelson N (2020) Temperature Sensitive Photosynthesis: Point Mutated CEF-G, PRK, or PsbO Act as Temperature-Controlled Switches for Essential Photosynthetic Processes. Frontiers in Plant Science 11:1465