Strains
CC-5875 FlvB CYP-3
$30.00
$30.00
From Adrien Burlacot, Carnegie Institution for Science, March 2022
Background and origin: flvB pgrl1 double mutant; parental strains flvB 21 mt+1 and pgrl1
Gene mutated: Cre16.g691800 ; Cre01.g007950.t1.1
Antibiotic resistance: Paromomycin
Sensitivity: short-term light fluctuations
Reference strain: CC5-155 and CC-4535
Burlacot A, Richaud P, Gosset A, Li-Beisson Y, Peltier G. Algal photosynthesis converts nitric oxide into nitrous oxide. Proc Natl Acad Sci U S A. 2020 Feb 4;117(5):2704-2709. doi: 10.1073/pnas.1915276117. Epub 2020 Jan 15. PMID: 31941711; PMCID: PMC7007583.
CC-5876 flvB pgrl1-1
$30.00
$30.00
From Adrien Burlacot, Carnegie Institution for Science, March 2022
Background and origin: flvB pgrl1 double mutant; parental strains flvB 21 mt+2 and pgrl1 (background CC-124)
Gene mutated: Cre07.g340200 ; Cre16.g691800
Antibiotic resistance: Paromomycin
Sensitivity: to low CO2, high light; light fluctuations
Reference strain: WT1, 2, 3, 4
Burlacot A, Dao O, Auroy P, Cuiné S, Li-Beisson Y, Peltier G. Alternative electron pathways of photosynthesis drive the algal CO2 concentrating mechanism. bioRxiv 2021.02.25.432959; doi: https://doi.org/10.1101/2021.02.25.432959
CC-5877 flvB pgrl1-2
$30.00
$30.00
From Adrien Burlacot, Carnegie Institution for Science, March 2022
Background and origin: flvB pgrl1 double mutant; parental strains flvB 21 mt+2 and pgrl1 (background CC-124)
Gene mutated: Cre07.g340200 ; Cre16.g691800
Antibiotic resistance: Paromomycin
Sensitivity: to low CO2, high light; light fluctuations
Reference strain: WT1, 2, 3, 4
Burlacot A, Dao O, Auroy P, Cuiné S, Li-Beisson Y, Peltier G. Alternative electron pathways of photosynthesis drive the algal CO2 concentrating mechanism. bioRxiv 2021.02.25.432959; doi: https://doi.org/10.1101/2021.02.25.432959
CC-5878 flvB pgrl1-3
$30.00
$30.00
From Adrien Burlacot, Carnegie Institution for Science, March 2022
Background and origin: flvB pgrl1 double mutant; parental strains flvB 21 mt+2 and pgrl1 (background CC-124)
Gene mutated: Cre07.g340200 ; Cre16.g691800
Antibiotic resistance: Paromomycin
Sensitivity: to low CO2, high light; light fluctuations
Reference strain: WT1, 2, 3, 4
Burlacot A, Dao O, Auroy P, Cuiné S, Li-Beisson Y, Peltier G. Alternative electron pathways of photosynthesis drive the algal CO2 concentrating mechanism. bioRxiv 2021.02.25.432959; doi: https://doi.org/10.1101/2021.02.25.432959
CC-5879 flvB pgrl1-4
$30.00
$30.00
From Adrien Burlacot, Carnegie Institution for Science, March 2022
Background and origin: flvB pgrl1 double mutant; parental strains flvB 21 mt+2 and pgrl1 (background CC-124)
Gene mutated: Cre07.g340200 ; Cre16.g691800
Antibiotic resistance: Paromomycin
Sensitivity: to low CO2, high light; light fluctuations
Reference strain: WT1, 2, 3, 4
Burlacot A, Dao O, Auroy P, Cuiné S, Li-Beisson Y, Peltier G. Alternative electron pathways of photosynthesis drive the algal CO2 concentrating mechanism. bioRxiv 2021.02.25.432959; doi: https://doi.org/10.1101/2021.02.25.432959
CC-5880 flvB pgrl1-5
$30.00
$30.00
From Adrien Burlacot, Carnegie Institution for Science, March 2022
Background and origin: flvB pgrl1 double mutant; parental strains flvB 21 mt+2 and pgrl1 (background CC-124)
Gene mutated: Cre07.g340200 ; Cre16.g691800
Antibiotic resistance: Paromomycin
Sensitivity: to low CO2, high light; light fluctuations
Reference strain: WT1, 2, 3, 4
Burlacot A, Dao O, Auroy P, Cuiné S, Li-Beisson Y, Peltier G. Alternative electron pathways of photosynthesis drive the algal CO2 concentrating mechanism. bioRxiv 2021.02.25.432959; doi: https://doi.org/10.1101/2021.02.25.432959
CC-5881 WT1
$30.00
$30.00
From Adrien Burlacot, Carnegie Institution for Science, March 2022
Background and origin: flvB pgrl1 double mutant; parental strains flvB 21 mt+2 and pgrl1 (background CC-124)
Burlacot A, Dao O, Auroy P, Cuiné S, Li-Beisson Y, Peltier G. Alternative electron pathways of photosynthesis drive the algal CO2 concentrating mechanism. bioRxiv 2021.02.25.432959; doi: https://doi.org/10.1101/2021.02.25.432959
CC-5882 WT2
$30.00
$30.00
From Adrien Burlacot, Carnegie Institution for Science, March 2022
Background and origin: flvB pgrl1 double mutant; parental strains flvB 21 mt+2 and pgrl1 (background CC-124)
Burlacot A, Dao O, Auroy P, Cuiné S, Li-Beisson Y, Peltier G. Alternative electron pathways of photosynthesis drive the algal CO2 concentrating mechanism. bioRxiv 2021.02.25.432959; doi: https://doi.org/10.1101/2021.02.25.432959
CC-5883 WT3
$30.00
$30.00
From Adrien Burlacot, Carnegie Institution for Science, March 2022
Background and origin: flvB pgrl1 double mutant; parental strains flvB 21 mt+2 and pgrl1 (background CC-124)
Burlacot A, Dao O, Auroy P, Cuiné S, Li-Beisson Y, Peltier G. Alternative electron pathways of photosynthesis drive the algal CO2 concentrating mechanism. bioRxiv 2021.02.25.432959; doi: https://doi.org/10.1101/2021.02.25.432959
CC-5884 WT4
$30.00
$30.00
From Adrien Burlacot, Carnegie Institution for Science, March 2022
Background and origin: flvB pgrl1 double mutant; parental strains flvB 21 mt+2 and pgrl1 (background CC-124)
Burlacot A, Dao O, Auroy P, Cuiné S, Li-Beisson Y, Peltier G. Alternative electron pathways of photosynthesis drive the algal CO2 concentrating mechanism. bioRxiv 2021.02.25.432959; doi: https://doi.org/10.1101/2021.02.25.432959
Deposited by Darius Rauch, Peter Hegemann lab, Humboldt University-Berlin, April 2022
This is a pCRY (CPH1) disruption strain, generated with CRISPR/Cas9.
Background strain: ROC40-LUC+ (from Takuya Matsuo, see Niwa et al. 2013)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
Target gene: pCRY (CPH1), Cre06.g295200
Target sequence: GACCTAGAGTGTGATGCGCT (Exon7)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
Deposited by Darius Rauch, Peter Hegemann lab, Humboldt University-Berlin, April 2022
This is a pCRY (CPH1) disruption strain, generated with CRISPR/Cas9.
Background strain: ROC40-LUC+ (from Takuya Matsuo, see Niwa et al. 2013)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
Target gene: pCRY (CPH1), Cre06.g295200
Target sequence: GACCTAGAGTGTGATGCGCT (Exon7)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
Deposited by Darius Rauch, Peter Hegemann lab, Humboldt University-Berlin, April 2022
This is a pCRY (CPH1) disruption strain, generated with CRISPR/Cas9.
Background strain: ROC40-LUC+ (from Takuya Matsuo, see Niwa et al. 2013)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
Target gene: pCRY (CPH1), Cre06.g295200
Target sequence: GACCTAGAGTGTGATGCGCT (Exon7)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
Deposited by Darius Rauch, Peter Hegemann lab, Humboldt University-Berlin, April 2022
This is a pCRY (CPH1) disruption strain, generated with CRISPR/Cas9.
Background strain: ROC40-LUC+ (from Takuya Matsuo, see Niwa et al. 2013)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
Target gene: pCRY (CPH1), Cre06.g295200
Target sequence: GACCTAGAGTGTGATGCGCT (Exon7)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
CC-5887 D5-1 [PH55]
$30.00
$30.00
Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University of Berlin,
April 2022
This strain was generated by insertion of the gene targeting selection (GTS) construct ble:yfp:mut-aphVIII containing SpCas9 target sites for the human EMX1 homeobox protein gene (Ran et al., 2015) and for ChR1 specific zinc finger nuclease (ZFN) into CC-3403 strain.
Background strain: CC-3403
Target genes: inactivated gene of the paromomycin resistance mut-aphVIII
ChR1 Cre14.g611300
Target sequences: SpCas9: ACTCCCTGGCCAGGCTTTGGGGAGGCC
ChR1 ZFN: CCCTCCGCCATGAGCGCCGGCGGCCG
This strain was published in Greiner et al 2017.
Overview of all strains from the Hegemann lab http://www.chlamy.de/strains
Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P. Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell. 2017 Oct;29(10):2498-2518. doi: 10.1105/tpc.17.00659. Epub 2017 Oct 4. PMID: 28978758; PMCID: PMC5774583.
CC-5887 D5-1 [PH55]
$30.00
$30.00
Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University of Berlin,
April 2022
This strain was generated by insertion of the gene targeting selection (GTS) construct ble:yfp:mut-aphVIII containing SpCas9 target sites for the human EMX1 homeobox protein gene (Ran et al., 2015) and for ChR1 specific zinc finger nuclease (ZFN) into CC-3403 strain.
Background strain: CC-3403
Target genes: inactivated gene of the paromomycin resistance mut-aphVIII
ChR1 Cre14.g611300
Target sequences: SpCas9: ACTCCCTGGCCAGGCTTTGGGGAGGCC
ChR1 ZFN: CCCTCCGCCATGAGCGCCGGCGGCCG
This strain was published in Greiner et al 2017.
Overview of all strains from the Hegemann lab http://www.chlamy.de/strains
Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P. Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell. 2017 Oct;29(10):2498-2518. doi: 10.1105/tpc.17.00659. Epub 2017 Oct 4. PMID: 28978758; PMCID: PMC5774583.
CC-5888 Chlamy/S
$30.00
$30.00
From Yoshinori Kawabe, Masamichi Kamihira Lab, Kyushu University, Japan, April 2022
The mutated loxP (mlox) sequence and spectinomycin resistance (Spec) genes were integrated in reverse directions into exon 1 of PNW74705 (GENE ID: CHLRE_12g486350v5))
Huang G, Kawabe Y, Shirakawa K, Akiyama T, Kamihira M. Novel transgenic Chlamydomonas reinhardtii strain with retargetable genomic transgene integration using Cre-loxP system. J Biosci Bioeng. 2021 Nov;132(5):469-478. doi: 10.1016/j.jbiosc.2021.07.006. Epub 2021 Aug 19. PMID: 34420898.
From Maria Mittag, Friedrich Schiller University-Jena, March 2022
Mittag lab copy of SAG 73.72 that originally came from The Culture Collection of Algae at Göttingen University (SAG). It is the ame strain as CC-3348.
CC-5890 shf-B [x]
$30.00
$30.00
From Karina Perlaza, Wallace Marshall lab, UCSF, March 2022
Background strain shf-B (LMJ.RY0402.172376)
Perlaza K, Mirvis M, Ishikawa H, Marshall W. The short flagella 1 (SHF1) gene in Chlamydomonas encodes a Crescerin TOG-domain protein required for late stages of flagellar growth. Mol Biol Cell. 2022 Feb 1;33(2):ar12. doi: 10.1091/mbc.E21-09-0472. Epub 2021 Nov 24. PMID: 34818077.
From Karina Perlaza, Wallace Marshall lab, UCSF, March 2022
Background strain shf-B (LMJ.RY0402.172376) expressing pkpl_1 plasmid.
Perlaza K, Mirvis M, Ishikawa H, Marshall W. The short flagella 1 (SHF1) gene in Chlamydomonas encodes a Crescerin TOG-domain protein required for late stages of flagellar growth. Mol Biol Cell. 2022 Feb 1;33(2):ar12. doi: 10.1091/mbc.E21-09-0472. Epub 2021 Nov 24. PMID: 34818077.
From Karina Perlaza, Wallace Marshall lab, UCSF, March 2022
Background strain shf-B (LMJ.RY0402.172376) expressing pkpl_2 plasmid.
Perlaza K, Mirvis M, Ishikawa H, Marshall W. The short flagella 1 (SHF1) gene in Chlamydomonas encodes a Crescerin TOG-domain protein required for late stages of flagellar growth. Mol Biol Cell. 2022 Feb 1;33(2):ar12. doi: 10.1091/mbc.E21-09-0472. Epub 2021 Nov 24. PMID: 34818077.
From Karina Perlaza, Wallace Marshall lab, UCSF, March 2022
Background strain CC-5325 expressing pkpl_2 plasmid.
Perlaza K, Mirvis M, Ishikawa H, Marshall W. The short flagella 1 (SHF1) gene in Chlamydomonas encodes a Crescerin TOG-domain protein required for late stages of flagellar growth. Mol Biol Cell. 2022 Feb 1;33(2):ar12. doi: 10.1091/mbc.E21-09-0472. Epub 2021 Nov 24. PMID: 34818077.
From Karina Perlaza, Wallace Marshall lab, UCSF, March 2022
Background strain CC-2347 shf1-277 mt- expressing pkpl_1_CrGFP plasmid.
Perlaza K, Mirvis M, Ishikawa H, Marshall W. The short flagella 1 (SHF1) gene in Chlamydomonas encodes a Crescerin TOG-domain protein required for late stages of flagellar growth. Mol Biol Cell. 2022 Feb 1;33(2):ar12. doi: 10.1091/mbc.E21-09-0472. Epub 2021 Nov 24. PMID: 34818077.
CC-5895 shf-A [“B2” 22A->]
$30.00
$30.00
From Karina Perlaza, Wallace Marshall lab, UCSF, March 2022
Resulting spore from shf-A strain backcrossed 2x to CC-125 with shf phenotype.
Perlaza K, Mirvis M, Ishikawa H, Marshall W. The short flagella 1 (SHF1) gene in Chlamydomonas encodes a Crescerin TOG-domain protein required for late stages of flagellar growth. Mol Biol Cell. 2022 Feb 1;33(2):ar12. doi: 10.1091/mbc.E21-09-0472. Epub 2021 Nov 24. PMID: 34818077.
From Karina Perlaza, Wallace Marshall lab, UCSF, March 2022
shf-A strain backcrossed 2x with shf phenotype, resulting spore expressing pkpl_1 plasmid.
Perlaza K, Mirvis M, Ishikawa H, Marshall W. The short flagella 1 (SHF1) gene in Chlamydomonas encodes a Crescerin TOG-domain protein required for late stages of flagellar growth. Mol Biol Cell. 2022 Feb 1;33(2):ar12. doi: 10.1091/mbc.E21-09-0472. Epub 2021 Nov 24. PMID: 34818077.
From Gui Zhang, Karl Lechtreck lab, University of Georgia, May 2022
Yu K, Liu P, Venkatachalam D, Hopkinson BM, Lechtreck KF. The BBSome restricts entry of tagged carbonic anhydrase 6 into the cis-flagellum of Chlamydomonas reinhardtii. PLoS One. 2020 Oct 29;15(10):e0240887. doi: 10.1371/journal.pone.0240887. PMID: 33119622; PMCID: PMC7595284.
CC-5898 bbs1 CAH6-Ng [#2]
$30.00
$30.00
From Gui Zhang, Karl Lechtreck lab, University of Georgia, May 2022
Yu K, Liu P, Venkatachalam D, Hopkinson BM, Lechtreck KF. The BBSome restricts entry of tagged carbonic anhydrase 6 into the cis-flagellum of Chlamydomonas reinhardtii. PLoS One. 2020 Oct 29;15(10):e0240887. doi: 10.1371/journal.pone.0240887. PMID: 33119622; PMCID: PMC7595284.
CC-5899 pkd2 PKD2-Ng-Hyg
$30.00
$30.00
From Gui Zhang, Karl Lechtreck lab, University of Georgia, May 2022
Liu P, Lou X, Wingfield JL, Lin J, Nicastro D, Lechtreck K. Chlamydomonas PKD2 organizes mastigonemes, hair-like glycoprotein polymers on cilia. J Cell Biol. 2020 Jun 1;219(6):e202001122. doi: 10.1083/jcb.202001122. PMID: 32348466; PMCID: PMC7265326.
From Adrian Nievergelt, Pigino Group, Max-Planck Institute for Cell and Molecular Biology-Dresden, August 2022
CC-4375 ift46-1 rescued with an IFT46 gene fused to a c-terminal mNeonGreen tag under the control of a PSAD promoter and it’s endogenous 5’ and 3’ UTRs.
Bright fluorescent green tag for IFT trains which is well suited for observation in TIRF or spinning disk microscopy. Resistant to paromomycin.
Nievergelt AP, Zykov I, Diener D, Chhatre A, Buchholz TO, Delling M, Diez S, Jug F, Štěpánek L, Pigino G. Conversion of anterograde into retrograde trains is an intrinsic property of intraflagellar transport. Curr Biol. 2022 Sep 26;32(18):4071-4078.e4. doi: 10.1016/j.cub.2022.07.033. Epub 2022 Aug 3. PMID: 35926510; PMCID: PMC9521741.
CC-5901 pf2; PF2-GcAMP6
$30.00
$30.00
From Adrian Nievergelt, Pigino Group, Max-Planck Institute for Cell and Molecular Biology-Dresden, August 2022
CC-513 pf2 mt- rescued with a pf2 gene fused to a c-terminal GcAMP6 tag under the control of it’s endogenous 5’ and 3’ UTRs and promoter. Insertional co-transformation with pSI103.
This strain expresses a free calcium reporter which is fused to DRC4 (pf2). The strain will show bright green flashes in calcium abundant media such as TAP, often correlated with motion of or touch of the flagella. Resistant to paromomycin.
Nievergelt AP, Zykov I, Diener D, Chhatre A, Buchholz TO, Delling M, Diez S, Jug F, Štěpánek L, Pigino G. Conversion of anterograde into retrograde trains is an intrinsic property of intraflagellar transport. Curr Biol. 2022 Sep 26;32(18):4071-4078.e4. doi: 10.1016/j.cub.2022.07.033. Epub 2022 Aug 3. PMID: 35926510; PMCID: PMC9521741.
- «Previous Page
- 1
- …
- 120
- 121
- 122
- 123
- 124
- …
- 132
- Next Page»