Strains
CC-5903 pf33
$30.00
$30.00
From Pinfen Yang, Marquette University, August 2022
This strain was recovered from UV mutagenesis by Ritsu Kamiya at Tokyo University. An MRC1 transposon is inserted in the 3’ UTR of the RSP16 (HSP40) gene.
Most cells have jerky flagella and small fraction of cells are motile. A trace amount of RSP16 is detected by Western blots of pf33 axonemes.
Zhu X, Poghosyan E, Rezabkova L, Mehall B, Sakakibara H, Hirono M, Kamiya R, Ishikawa T, Yang P. The roles of a flagellar HSP40 ensuring rhythmic beating. Mol Biol Cell. 2019 Jan 15;30(2):228-241. doi: 10.1091/mbc.E18-01-0047. Epub 2018 Nov 14. PMID: 30427757; PMCID: PMC6589562.
From George Witman, University of Massachusetts Medical School, August 2022
This strain was generated by the TIM method, a targeted insertional mutagenesis approach utilizing CRISPR/Cas9 and is paromomycin resistant.
It is from the experiment of Row 14 repeat 2 in Table 1 of Picariello, Hou et al., (2020) using donor DNA containing the paromomycin-resistant cassette and 50-bp homology arms.
Picariello T, Hou Y, Kubo T, McNeill NA, Yanagisawa HA, Oda T, Witman GB. TIM, a targeted insertional mutagenesis method utilizing CRISPR/Cas9 in Chlamydomonas reinhardtii. PLoS One. 2020 May 13;15(5):e0232594. doi: 10.1371/journal.pone.0232594. PMID: 32401787; PMCID: PMC7219734.
From George Witman, University of Massachusetts Medical School, August 2022
This strain was generated by the TIM method, a targeted insertional mutagenesis approach utilizing CRISPR/Cas9 and is paromomycin resistant.
It is from the experiment of Row 14 repeat 2 in Table 1 of Picariello, Hou et al., (2020) using donor DNA containing the paromomycin-resistant cassette and 50-bp homology arms.
Picariello T, Hou Y, Kubo T, McNeill NA, Yanagisawa HA, Oda T, Witman GB. TIM, a targeted insertional mutagenesis method utilizing CRISPR/Cas9 in Chlamydomonas reinhardtii. PLoS One. 2020 May 13;15(5):e0232594. doi: 10.1371/journal.pone.0232594. PMID: 32401787; PMCID: PMC7219734.
From George Witman, University of Massachusetts Medical School, August 2022
This strain was generated by the TIM method, a targeted insertional mutagenesis approach utilizing CRISPR/Cas9 and is paromomycin resistant.
It is from the experiment of Row 14 repeat 2 in Table 1 of Picariello, Hou et al., (2020) using donor DNA containing the paromomycin-resistant cassette and 50-bp homology arms.
Picariello T, Hou Y, Kubo T, McNeill NA, Yanagisawa HA, Oda T, Witman GB. TIM, a targeted insertional mutagenesis method utilizing CRISPR/Cas9 in Chlamydomonas reinhardtii. PLoS One. 2020 May 13;15(5):e0232594. doi: 10.1371/journal.pone.0232594. PMID: 32401787; PMCID: PMC7219734.
From George Witman, University of Massachusetts Medical School, August 2022
This strain was generated by the TIM method, a targeted insertional mutagenesis approach utilizing CRISPR/Cas9 and is paromomycin resistant.
It is from the experiment of Row 14 repeat 2 in Table 1 of Picariello, Hou et al., (2020) using donor DNA containing the paromomycin-resistant cassette and 50-bp homology arms.
Picariello T, Hou Y, Kubo T, McNeill NA, Yanagisawa HA, Oda T, Witman GB. TIM, a targeted insertional mutagenesis method utilizing CRISPR/Cas9 in Chlamydomonas reinhardtii. PLoS One. 2020 May 13;15(5):e0232594. doi: 10.1371/journal.pone.0232594. PMID: 32401787; PMCID: PMC7219734.
From Susan Dutcher, Washington University in St. Louis, September 2022
Strain 6B10 (background CC-124) containing an insertion of aphviii in the ATG11 gene (Lin, Cliften & Dutcher, 2018) was crossed to a strain of mixed background with genotype ac17; NIT2; ery1.
This strain fails to grow in medium lacking acetate. It also does not grow in minimal (M) medium and is resistant to paromomycin. The ATG17 gene was previously annotated and published as ATG11.
Payne, Z.L., Penny, G.M., Turner, T.N., & Dutcher, S.K. Detection of Translocations Induced by Site-Directed CRISPR/Cas9 Mutagenesis Enabled By Long-Read Genome Assembly of Chlamydomonas reinhardttii – In revision, main manuscript
Lin H, Cliften PF, Dutcher SK. MAPINS, a Highly Efficient Detection Method That Identifies Insertional Mutations and Complex DNA Rearrangements. Plant Physiol. 2018 Dec;178(4):1436-1447. doi: 10.1104/pp.18.00474. Epub 2018 Sep 11. PMID: 30206105; PMCID: PMC6288735.
From Susan Dutcher, Washington University in St. Louis, September 2022
Strain 6B10 (background CC-124) containing an insertion of aphviii in the ATG11 gene (Lin, Cliften & Dutcher, 2018) was crossed to a strain of mixed background with genotype ac17; NIT2; ery1.
This strain fails to grow in medium lacking acetate. It also does not grow in minimal (M) medium and is resistant to paromomycin. The ATG17 gene was previously annotated and published as ATG11.
Payne, Z.L., Penny, G.M., Turner, T.N., & Dutcher, S.K. Detection of Translocations Induced by Site-Directed CRISPR/Cas9 Mutagenesis Enabled By Long-Read Genome Assembly of Chlamydomonas reinhardttii – In revision, main manuscript
Lin H, Cliften PF, Dutcher SK. MAPINS, a Highly Efficient Detection Method That Identifies Insertional Mutations and Complex DNA Rearrangements. Plant Physiol. 2018 Dec;178(4):1436-1447. doi: 10.1104/pp.18.00474. Epub 2018 Sep 11. PMID: 30206105; PMCID: PMC6288735.
CC-5912 gspk (exon-3) mt+
$30.00
$30.00
From Peeyush Ranjan, Snell lab, University of Maryland College Park, September 2022
This strain has a mutation in the exon-3 region. It was created by crossing the gspk CLiP mutant LMJ.RY0402.138658 (mt-) with wild type 21gr (mt+) cells. Selection was by antibiotic resistance (aphVIII) and colony PCR using the CHELEX method.
Awasthi M, Ranjan P, Kelterborn S, Hegemann P, Snell WJ. A cytoplasmic protein kinase couples engagement of Chlamydomonas ciliary receptors to cAMP-dependent cellular responses. J Cell Sci. 2022 May 15;135(10):jcs259814. doi: 10.1242/jcs.259814. Epub 2022 May 23. PMID: 35502650; PMCID: PMC9189427.
CC-5913 GSPK-HA mt+
$30.00
$30.00
From Peeyush Ranjan, Snell lab, University of Maryland College Park, September 2022
This strain was created by the transformation of wild type 21gr(mt+) cells with the gspk transgene from Cre02.g104450 with a C-terminal 3XHA tag regulated by endogenous promoter.
Awasthi M, Ranjan P, Kelterborn S, Hegemann P, Snell WJ. A cytoplasmic protein kinase couples engagement of Chlamydomonas ciliary receptors to cAMP-dependent cellular responses. J Cell Sci. 2022 May 15;135(10):jcs259814. doi: 10.1242/jcs.259814. Epub 2022 May 23. PMID: 35502650; PMCID: PMC9189427.
CC-5914 gspk (3’UTR) mt+
$30.00
$30.00
From Peeyush Ranjan, Snell lab, University of Maryland College Park, September 2022
This strain has a mutation in the 3’UTR region. It was created by crossing the gspk CLiP mutant LMJ.RY0402.039382 (mt-) with wild type 21gr (mt+) cells. Selection was by antibiotic resistance (aphVIII) and colony PCR using the CHELEX method.
Awasthi M, Ranjan P, Kelterborn S, Hegemann P, Snell WJ. A cytoplasmic protein kinase couples engagement of Chlamydomonas ciliary receptors to cAMP-dependent cellular responses. J Cell Sci. 2022 May 15;135(10):jcs259814. doi: 10.1242/jcs.259814. Epub 2022 May 23. PMID: 35502650; PMCID: PMC9189427.
CC-5915 PKA mt+
$30.00
$30.00
From Peeyush Ranjan, Snell lab, University of Maryland College Park, September 2022
CC-5325 (mt-) cells were transformed with the pka transgene from Cre16.g669800 with a C-terminal 3XHA tag regulated by an endogenous promoter. It was generated by Mayanka Awasthi and Peeyush Ranjan in the lab of Prof. William J. Snell.
CC-5916 gspk mt-
$30.00
$30.00
From Peeyush Ranjan, Snell lab, University of Maryland College Park, September 2022
This strain was created by backcrossing CC-5912 gspk (exon-3) mt+ with CC-5325 (mt-)
Awasthi M, Ranjan P, Kelterborn S, Hegemann P, Snell WJ. A cytoplasmic protein kinase couples engagement of Chlamydomonas ciliary receptors to cAMP-dependent cellular responses. J Cell Sci. 2022 May 15;135(10):jcs259814. doi: 10.1242/jcs.259814. Epub 2022 May 23. PMID: 35502650; PMCID: PMC9189427.
CC-5917 gspk; GSPK-HA mt-
$30.00
$30.00
From Peeyush Ranjan, Snell lab, University of Maryland College Park, September 2022
GSPK rescued gspk(mt-) mutant
Awasthi M, Ranjan P, Kelterborn S, Hegemann P, Snell WJ. A cytoplasmic protein kinase couples engagement of Chlamydomonas ciliary receptors to cAMP-dependent cellular responses. J Cell Sci. 2022 May 15;135(10):jcs259814. doi: 10.1242/jcs.259814. Epub 2022 May 23. PMID: 35502650; PMCID: PMC9189427.
CC-5918 GSPK-HA mt-
$30.00
$30.00
From Peeyush Ranjan, Snell lab, University of Maryland College Park, September 2022
This strain was created by mating GSPK-3XHA expressing cells with CC-5325 (mt-).
Awasthi M, Ranjan P, Kelterborn S, Hegemann P, Snell WJ. A cytoplasmic protein kinase couples engagement of Chlamydomonas ciliary receptors to cAMP-dependent cellular responses. J Cell Sci. 2022 May 15;135(10):jcs259814. doi: 10.1242/jcs.259814. Epub 2022 May 23. PMID: 35502650; PMCID: PMC9189427.
CC-5919 GSPK-HA-mNeon
$30.00
$30.00
From Peeyush Ranjan, Snell lab, University of Maryland College Park, September 2022
This strain was created by transforming 21gr (mt+) with a C-terminal mNeon tag with an endogenous promoter.
Awasthi M, Ranjan P, Kelterborn S, Hegemann P, Snell WJ. A cytoplasmic protein kinase couples engagement of Chlamydomonas ciliary receptors to cAMP-dependent cellular responses. J Cell Sci. 2022 May 15;135(10):jcs259814. doi: 10.1242/jcs.259814. Epub 2022 May 23. PMID: 35502650; PMCID: PMC9189427.
CC-5920 gspk; GSPK-HA mt+
$30.00
$30.00
From Peeyush Ranjan, Snell lab, University of Maryland College Park, September 2022
GSPK rescued gspk(mt+) mutant
Awasthi M, Ranjan P, Kelterborn S, Hegemann P, Snell WJ. A cytoplasmic protein kinase couples engagement of Chlamydomonas ciliary receptors to cAMP-dependent cellular responses. J Cell Sci. 2022 May 15;135(10):jcs259814. doi: 10.1242/jcs.259814. Epub 2022 May 23. PMID: 35502650; PMCID: PMC9189427.
CC-5921 sag1-5; SAG1-HA
$30.00
$30.00
From Peeyush Ranjan, Snell lab, University of Maryland College Park, September 2022
CC-469 imp5 (Sag1) mt+ rescued with a SAG1 transgene encoding a C-terminal HA tag.
Belzile O, Hernandez-Lara CI, Wang Q, Snell WJ. Regulated membrane protein entry into flagella is facilitated by cytoplasmic microtubules and does not require IFT. Curr Biol. 2013 Aug 5;23(15):1460-5. doi: 10.1016/j.cub.2013.06.025. Epub 2013 Jul 25. PMID: 23891117; PMCID: PMC3740039.
Cao M, Ning J, Hernandez-Lara CI, Belzile O, Wang Q, Dutcher SK, Liu Y, Snell WJ. Uni-directional ciliary membrane protein trafficking by a cytoplasmic retrograde IFT motor and ciliary ectosome shedding. Elife. 2015 Feb 17;4:e05242. doi: 10.7554/eLife.05242. PMID: 25688564; PMCID: PMC4362204.
Ranjan P, Awasthi M, Snell WJ. Transient Internalization and Microtubule-Dependent Trafficking of a Ciliary Signaling Receptor from the Plasma Membrane to the Cilium. Curr Biol. 2019 Sep 9;29(17):2942-2947.e2. doi: 10.1016/j.cub.2019.07.022. Epub 2019 Aug 15. PMID: 31422889; PMCID: PMC6736722.
From Saul Purton, University College London, August 2023
Origin: psaA-3::aadA knockout in which part of the psaA-3 coding region and 3’ UTR is replaced with the aadA cassette through chloroplast transformation. Background strain is CC-1690.
Culture maintenance: Acetate-requiring, light-sensitive (ΔPSI mutant)
Comment: This strain was created to serve as a recipient for chloroplast transformation where selection is based on restoration of light-insensitivity (and phototrophy) using the WT psaA-3 gene as the marker.
Taunt HN, Jackson HO, Gunnarsson ÍN, Pervaiz R, Purton S. Accelerating Chloroplast Engineering: A New System for Rapid Generation of Marker-Free Transplastomic Lines of Chlamydomonas reinhardtii. Microorganisms. 2023 Jul 31;11(8):1967. doi: 10.3390/microorganisms11081967. PMID: 37630526; PMCID: PMC10457852.
CC-5952 ∆Ku80-G10 [PH096]
$30.00
$30.00
Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.
This is a KU80 disruption strain, generated with SpCas9 based on the CC-125 strain.
Background strain: CC-125 mt+
Nuclease: SpCas9
Knock-out generated using CRISPR/Cas9 and FLAG sequence ATAATGACCACGACATCGACTACAAGGACT to disrupt the gene of interest.
Target gene: KU80, Cre10.g423800
Target sequence: ggcggcaggaccagcctgga
Marker: pAphVII (pPH360)
This strain was not published. Please contact irinasiz@yahoo.com before using it.
Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.
This is a Rad51C disruption strain, generated with SpCas9 based on the CC-125 strain. Knock-out generated using CRISPR/Cas9 and FLAG sequence CGCCCACGCtAATTaGCGTGGGCGcgtga to disrupt the gene of interest. It contains FLAG sequence + an unidentified DNA sequence inserted at the disruption site.
Background strain: CC-125 mt+
Nuclease: SpCas9
Target gene: Rad51C, Cre02.g102500
Target sequence: TCTCGCCACTGGTTTCGGCA
Marker: pAphVII (pPH360)
This strain was not published. Please contact irinasiz@yahoo.com before using it.
Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.
This is a Rad51C disruption strain, generated with SpCas9 based on the CC-125 strain. Knock-out generated using CRISPR/Cas9 and FLAG sequence CGCCCACGCtAATTaGCGTGGGCGcgtga to disrupt the gene of interest. It contains FLAG sequence + an unidentified DNA sequence inserted at the disruption site.
Background strain: CC-125 mt+
Nuclease: SpCas9
Target gene: Rad51C, Cre02.g102500
Target sequence: TCTCGCCACTGGTTTCGGCA
Marker: pAphVII (pPH360)
This strain was not published. Please contact irinasiz@yahoo.com before using it.
Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.
This is a Rad51C disruption strain, generated with SpCas9 based on the CC-125 strain. Knock-out generated using CRISPR/Cas9 and FLAG sequence CGCCCACGCtAATTaGCGTGGGCGcgtga to disrupt the gene of interest. It contains FLAG sequence + an unidentified DNA sequence inserted at the disruption site.
Background strain: CC-125 mt+
Nuclease: SpCas9
Target gene: Rad51C, Cre02.g102500
Target sequence: TCTCGCCACTGGTTTCGGCA
Marker: pAphVII (pPH360)
This strain was not published. Please contact irinasiz@yahoo.com before using it.
Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.
This is a Rad51C disruption strain, generated with SpCas9 based on the CC-125 strain. Knock-out generated using CRISPR/Cas9 and FLAG sequence CGCCCACGCtAATTaGCGTGGGCGcgtga to disrupt the gene of interest. It contains FLAG sequence + an unidentified DNA sequence inserted at the disruption site.
Background strain: CC-125 mt+
Nuclease: SpCas9
Target gene: Rad51C, Cre02.g102500
Target sequence: TCTCGCCACTGGTTTCGGCA
Marker: pAphVII (pPH360)
This strain was not published. Please contact irinasiz@yahoo.com before using it.
Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.
This is a Rad51C disruption strain, generated with SpCas9 based on the CC-5887 D5-1 [PH55] strain containing the gene targeting selection construct ble:yfp:mut-aphVIII. Knock-out generated using CRISPR/Cas9 and FLAG sequence CGCCCACGCTAATTAGCGTGGGCGCGTGAG to disrupt the gene of interest. It contains the 185 bp insert including FLAG sequence + an unidentified DNA sequence at the disruption site.
Background strain: CC-5887 D5-1
Nuclease: SpCas9
Target gene: Rad51C, Cre02.g102500
Target sequence: TCTCGCCACTGGTTTCGGCA
Marker: pAphVII (pPH360)
This strain was not published. Please contact irinasiz@yahoo.com before using it.
Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.
This is a Rad51C disruption strain, generated with SpCas9 based on the CC-5887 D5-1 [PH55] strain containing the gene targeting selection construct ble:yfp:mut-aphVIII. Knock-out generated using CRISPR/Cas9 and FLAG sequence CGCCCACGCTAATTAGCGTGGGCGCGTGAG to disrupt the gene of interest. It contains the 55 bp insert including FLAG sequence + the 25 bp fragment of the chromosomal DNA at the disruption site.
Background strain: CC-5887 D5-1
Nuclease: SpCas9
Target gene: Rad51C, Cre02.g102500
Target sequence: TCTCGCCACTGGTTTCGGCA
Marker: pAphVII (pPH360)
This strain was not published. Please contact irinasiz@yahoo.com before using it.
CC-5959 ChR1-E162T [PH106]
$30.00
$30.00
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.
This is a strain with a point mutation E162T in ChR1, generated with SpCas9 nuclease.
Background strain: CC-125 mt+
Nuclease: SpCas9 nuclease
Target gene: ChR1, Cre14.g611300
Target sequence: ChR1 TGTGGCTTCGTTACGCGGAG (exon 5)
Marker: pAphVII (pPH360), pAphVIII (pPH114)
Mutation: E162T exchange in ChR1
Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.
This is a ChR1 and ChR2 disruption strain, generated with SpCas9 nuclease.
Background strain: CC-125 mt+
Nuclease: SpCas9 nuclease
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: ChR1 TGTGGCTTCGTTACGCGGAG (exon 5); ChR2 AGTGGTTGCGTTACGCCGAG (exon 6)
Marker: pAphVII (pPH360), pAphVIII (pPH114)
Mutation: insertion of short oligo TTTCGATTGAAGGAAAAGTTACAACGGAGT in ChR1 and ChR2
Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.
Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.
This is a ChR1 disruption strain with a point mutation E90Q in ChR2, generated with Zif and SpCas9 nucleases.
Background strain: CC-125 mt+
Nuclease: Zif and SpCas9 nucleases
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: ChR1 TGTGGCTTCGTTACGCGGAG (exon 5); ChR2 CTATGTGTGCGCTATCGAGG (exon 4)
Marker: pAphVII (pPH360), pAphVIII (pPH114), pCrZ3 (pPH68)
Mutation: E90Q exchange in ChR2; insertion of short oligo TTTCGATTGAAGGAAAAGTTACAACGGAGT in ChR1
This strain was not published. Please contact irinasiz@yahoo.com before using it.
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.
This is a ChR1 disruption strain with a point mutation E90R in ChR2, generated with SpCas9 nuclease.
Background strain: CC-125 mt+
Nuclease: SpCas9 nuclease
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: ChR1 TGTGGCTTCGTTACGCGGAG (exon 5); ChR2 CTATGTGTGCGCTATCGAGG (exon 4)
Marker: pAphVII (pPH360), pAphVIII (pPH114)
Mutation: E90R exchange in ChR2; insertion of short oligo
Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.
This is a ChR1 disruption strain with a point mutation E90R in ChR2, generated with SpCas9 nuclease
Background strain: CC-125 mt+
Nuclease: SpCas9 nuclease
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: ChR1 TGTGGCTTCGTTACGCGGAG (exon 5); ChR2 CTATGTGTGCGCTATCGAGG (exon 4)
Marker: pAphVII (pPH360), pAphVIII (pPH114)
Mutation: E90R exchange in ChR2; insertion of short oligo TTTCGATTGAAGGAAAAGTTACAACGGAGT in ChR1
Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.