Strains

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.

This is a strain with a point mutation E162T in ChR1, generated with SpCas9 nuclease.

Background strain: CC-125 mt+
Nuclease: SpCas9 nuclease
Target gene: ChR1, Cre14.g611300 
Target sequence: ChR1 TGTGGCTTCGTTACGCGGAG (exon 5)
Marker: pAphVII (pPH360), pAphVIII (pPH114)
Mutation: E162T exchange in ChR1

Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.

  • Locus:
  • ChR1, Cre14.g611300
  • Chromosome:
  • 14

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.

This is a ChR1 and ChR2 disruption strain, generated with SpCas9 nuclease.

Background strain: CC-125 mt+
Nuclease: SpCas9 nuclease
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: ChR1 TGTGGCTTCGTTACGCGGAG (exon 5); ChR2 AGTGGTTGCGTTACGCCGAG (exon 6)
Marker: pAphVII (pPH360), pAphVIII (pPH114)
Mutation: insertion of short oligo TTTCGATTGAAGGAAAAGTTACAACGGAGT in ChR1 and ChR2

Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.

  • Locus:
  • ChR1, Cre14.g611300; ChR2, Cre02.g085257
  • Chromosome:
  • 14, 2

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.

This is a ChR1 disruption strain with a point mutation E90Q in ChR2, generated with Zif and SpCas9 nucleases.

Background strain: CC-125 mt+
Nuclease: Zif and SpCas9 nucleases
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: ChR1 TGTGGCTTCGTTACGCGGAG (exon 5); ChR2 CTATGTGTGCGCTATCGAGG (exon 4)
Marker: pAphVII (pPH360), pAphVIII (pPH114), pCrZ3 (pPH68)
Mutation: E90Q exchange in ChR2; insertion of short oligo TTTCGATTGAAGGAAAAGTTACAACGGAGT in ChR1

This strain was not published. Please contact irinasiz@yahoo.com before using it.

  • Locus:
  • ChR1, Cre14.g611300; ChR2, Cre02.g085257
  • Chromosome:
  • 14, 2

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.

This is a ChR1 disruption strain with a point mutation E90R in ChR2, generated with SpCas9 nuclease.

Background strain: CC-125 mt+
Nuclease: SpCas9 nuclease
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: ChR1 TGTGGCTTCGTTACGCGGAG (exon 5); ChR2 CTATGTGTGCGCTATCGAGG (exon 4)
Marker: pAphVII (pPH360), pAphVIII (pPH114)
Mutation: E90R exchange in ChR2; insertion of short oligo 

Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.

  • Locus:
  • ChR1, Cre14.g611300; ChR2, Cre02.g085257
  • Chromosome:
  • 14, 2

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.

This is a ChR1 disruption strain with a point mutation E90R in ChR2, generated with SpCas9 nuclease

Background strain: CC-125 mt+
Nuclease: SpCas9 nuclease
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: ChR1 TGTGGCTTCGTTACGCGGAG (exon 5); ChR2 CTATGTGTGCGCTATCGAGG (exon 4)
Marker: pAphVII (pPH360), pAphVIII (pPH114)
Mutation: E90R exchange in ChR2; insertion of short oligo TTTCGATTGAAGGAAAAGTTACAACGGAGT in ChR1

Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.

  • Locus:
  • ChR1, Cre14.g611300; ChR2, Cre02.g085257
  • Chromosome:
  • 14, 2

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.

This is a ChR1 disruption strain with a point mutation E90R in ChR2, generated with SpCas9 nuclease.

Background strain: CC-125 mt+
Nuclease: SpCas9 nuclease
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: ChR1 TGTGGCTTCGTTACGCGGAG (exon 5); ChR2 CTATGTGTGCGCTATCGAGG (exon 4)
Marker: pAphVII (pPH360), pAphVIII (pPH114)
Mutation: E90R exchange in ChR2; insertion of short oligo TTTCGATTGAAGGAAAAGTTACAACGGAGT in ChR1

Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.

  • Locus:
  • ChR1, Cre14.g611300; ChR2, Cre02.g085257
  • Chromosome:
  • 14, 2

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.

This is a ChR1 disruption strain with a point mutation E90Q in ChR2, generated with SpCas9 nuclease in CC-125 and crossed into CC-124.

Background strain: CC-124 mt-
Nuclease: SpCas9 nuclease
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: ChR1 TGTGGCTTCGTTACGCGGAG (exon 5);ChR2 CTATGTGTGCGCTATCGAGG (exon 4)
Mutation: E90R exchange in ChR2; insertion of short oligo TTTCGATTGAAGGAAAAGTTACAACGGAGT in ChR1

This is an unpublished strain. Please contact ph@chlamy.de before using it.

  • Locus:
  • ChR1, Cre14.g611300; ChR2, Cre02.g085257
  • Chromosome:
  • 14, 2

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.

This is a ChR2 disruption strain with a point mutation E162T in ChR1, generated with SpCas9 nuclease in CC-125 and crossed into CC-124.

Background strain: CC-124 mt-
Nuclease: SpCas9 nuclease
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: ChR1 TGTGGCTTCGTTACGCGGAG (exon 5); ChR2 CTATGTGTGCGCTATCGAGG (exon 4)
Mutation: E162T exchange in ChR1; insertion of short oligo TTAGCTAAGCCTCCCCAAAGCCTGGCCAGGGTCTAG in ChR2

This is an unpublished strain. Please contact ph@chlamy.de before using it.

  • Locus:
  • ChR1, Cre14.g611300; ChR2, Cre02.g085257
  • Chromosome:
  • 14, 2

Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, December 2022

This is a ChR1 disruption strain with a point mutation E123T in ChR2, generated with Zif and SpCas9 nucleases.

Background strain: CC-3403
Nuclease: SpCas9 and Zif nucleases
Target gene: ChR2, Cre02.g085257
Target sequence: ChR2 AGTGGTTGCGTTACGCCGAG (exon 6)
Marker: pAphVIII (pPH114), pArg+ (pPH230)
Mutation: E123T exchange in ChR2

This is an unpublished strain. Please contact ph@chlamy.de before using it.

  • Locus:
  • Chromosome:
  • ChR2, Cre02.g085257

Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, December 2022

This is a SNRK2.2 (SAC3) disruption strain, generated with CRISPR/Cas9. Clone C5-A5.

Mutants with a disrupted SNRK2.2 (SAC3) gene show constitutive arylsulfatase expression and can phenotypically screened with X-SO4 dyes (see Kelterborn et al. 2022, doi.org/10.1007/978-1-0716-1791-5_3).

Background strain: SAG11-32b (=CC-409)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: SNRK2.2, Cre12.g499500
Target sequence: TAGCGAGGATGTCCAATCAG GGG (exon 1)
Mutation: insertion of short oligo (TTAGACTCTAACTAGATCAGcgg)

Overview of all CRISPR/Cas9 strains from the Hegemann lab: http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

  • Locus:
  • SNRK2.2, Cre12.g499500
  • Chromosome:
  • 12

Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, December 2022

This is a SNRK2.2 (SAC3) disruption strain, generated with CRISPR/Cas9. Clone C10-A10.

Mutants with a disrupted SNRK2.2 (SAC3) gene show constitutive arylsulfatase expression and can phenotypically screened with X-SO4 dyes (see Kelterborn et al. 2022, doi.org/10.1007/978-1-0716-1791-5_3).

Background strain: SAG11-32b (=CC-409)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: SNRK2.2, Cre12.g499500
Target sequence: TAGCGAGGATGTCCAATCAG GGG (exon 1)
Mutation: insertion of short oligo (TTAGACTCTAACTAGATCAGcgg)

Overview of all CRISPR/Cas9 strains from the Hegemann lab: http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

  • Locus:
  • SNRK2.2, Cre12.g499500
  • Chromosome:
  • 12

From George Witman, University of Massachusetts Medical School, January 2023

Background: CC-5415 nit1 agg1 mt+ [Witman g1]

Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.

Comment: This strain was one of the strains shown in Figures 6 and 7 of Hou et al., (2022). The endogenous LF5 allele was tagged with 3HA in front of the stop codon.

Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.

  • Locus:
  • LF5, Cre12.g538300
  • Chromosome:
  • 12

From George Witman, University of Massachusetts Medical School, January 2023

Background: CC-5415 nit1 agg1 mt+ [Witman g1]

Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.

Comment: This strain was one of the strains shown in Figures 6 and 7 of Hou et al., (2022). The endogenous LF5 allele was tagged with 3HA in front of the stop codon.

Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.

  • Locus:
  • LF5, Cre12.g538300
  • Chromosome:
  • 12

From George Witman, University of Massachusetts Medical School, January 2023

Background: CC-5415 nit1 agg1 mt+ [Witman g1]

Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.

Comment: This strain was one of the strains shown in Figures 6 and 7 of Hou et al., (2022). The endogenous LF5 allele was tagged with 3HA in front of the stop codon.

Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.

  • Locus:
  • Chromosome:
  • LF5, Cre12.g538300

From George Witman, University of Massachusetts Medical School, January 2023

Background: CC-5415 nit1 agg1 mt+ [Witman g1]

Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.

Comment: This strain was one of the strains shown in Figures 6 and 7 of Hou et al., (2022). The endogenous LF5 allele was tagged with 3HA in front of the stop codon.

Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.

  • Locus:
  • LF5, Cre12.g538300
  • Chromosome:
  • 12

From George Witman, University of Massachusetts Medical School, January 2023

Background: CC-5415 nit1 agg1 mt+ [Witman g1]

Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.

Comment: This strain was one of the strains shown in Figures 6 and 7 of Hou et al., (2022). The endogenous LF5 allele was tagged with 3HA in front of the stop codon.

Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.

  • Locus:
  • LF5, Cre12.g538300
  • Chromosome:
  • 12

From George Witman, University of Massachusetts Medical School, January 2023

Background: CC-5415 nit1 agg1 mt+ [Witman g1]

Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.

Comment: This strain was one of the strains shown in Figures 6 and 7 of Hou et al., (2022). The endogenous LF5 allele was tagged with 3HA in front of the stop codon.

Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.

  • Locus:
  • LF5, Cre12.g538300
  • Chromosome:
  • 12

From George Witman, University of Massachusetts Medical School, January 2023

Background: CC-5415 nit1 agg1 mt+ [Witman g1]

Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.

Comment: This strain was one of the strains shown in Figures 6 and 7 of Hou et al., (2022). The endogenous LF5 allele was tagged with 3HA in front of the stop codon.

Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.

  • Locus:
  • LF5, Cre12.g538300
  • Chromosome:
  • 12

From George Witman, University of Massachusetts Medical School, January 2023

Background: CC-5415 nit1 agg1 mt+ [Witman g1]

Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.

Comment: This strain was one of the strains shown in Figures 8, 9, and 11 of Hou et al., (2022). The endogenous NAP1L1 allele was tagged with mNeonGreen-3xFLAG after the start codon.

Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.

  • Locus:
  • NAP1L1, Cre09.g416350
  • Chromosome:
  • 9

From George Witman, University of Massachusetts Medical School, January 2023

Background: CC-5415 nit1 agg1 mt+ [Witman g1]

Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.

Comment: This strain was one of the strains shown in Figures 8, 9, and 11 of Hou et al., (2022). The endogenous NAP1L1 allele was tagged with mNeonGreen-3xFLAG after the start codon.

Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.

  • Locus:
  • NAP1L1, Cre09.g416350
  • Chromosome:
  • 9

From George Witman, University of Massachusetts Medical School, January 2023

Background: CC-5415 nit1 agg1 mt+ [Witman g1]

Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.

Comment: This strain was one of the strains shown in Figures 8, 9, and 11 of Hou et al., (2022). The endogenous NAP1L1 allele was tagged with mNeonGreen-3xFLAG after the start codon.

Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.

  • Locus:
  • NAP1L1, Cre09.g416350
  • Chromosome:
  • 9

From George Witman, University of Massachusetts Medical School, January 2023

Background: CC-5415 nit1 agg1 mt+ [Witman g1]

Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.

Comment: This strain was one of the strains shown in Figures 8, 9, and 11 of Hou et al., (2022). The endogenous NAP1L1 allele was tagged with mNeonGreen-3xFLAG after the start codon.

Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.

  • Locus:
  • NAP1L1, Cre09.g416350
  • Chromosome:
  • 9

From George Witman, University of Massachusetts Medical School, January 2023

Background: CC-5415 nit1 agg1 mt+ [Witman g1]

Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.

Comment: This strain was one of the strains shown in Figures 8, 9, and 11 of Hou et al., (2022). The endogenous NAP1L1 allele was tagged with mNeonGreen-3xFLAG after the start codon.

Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.

  • Locus:
  • NAP1L1, Cre09.g416350
  • Chromosome:
  • 9

From George Witman, University of Massachusetts Medical School, January 2023

Background: CC-5415 nit1 agg1 mt+ [Witman g1]

Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.

Comment: This strain was one of the strains shown in Figures 8, 9, and 11 of Hou et al., (2022). The endogenous NAP1L1 allele was tagged with mNeonGreen-3xFLAG after the start codon.

Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.

  • Locus:
  • NAP1L1, Cre09.g416350
  • Chromosome:
  • 9

From George Witman, University of Massachusetts Medical School, January 2023

Background: CC-5415 nit1 agg1 mt+ [Witman g1]

Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.

Comment: This strain was one of the strains shown in Figures 8, 9, and 11 of Hou et al., (2022). The endogenous NAP1L1 allele was tagged with mNeonGreen-3xFLAG after the start codon.

Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.

  • Locus:
  • NAP1L1, Cre09.g416350
  • Chromosome:
  • 9

From George Witman, University of Massachusetts Medical School, January 2023

Background: CC-5415 nit1 agg1 mt+ [Witman g1]

Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.

Comment: This strain was one of the strains shown in Figures 8, 9, and 11 of Hou et al., (2022). The endogenous NAP1L1 allele was tagged with mNeonGreen-3xFLAG after the start codon.

Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.

  • Locus:
  • NAP1L1, Cre09.g416350
  • Chromosome:
  • 9

From George Witman, University of Massachusetts Medical School, January 2023

Background: CC-5415 nit1 agg1 mt+ [Witman g1]

Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.

Comment: This strain was one of the strains shown in Figures 8, 9, and 11 of Hou et al., (2022). The endogenous NAP1L1 allele was tagged with mNeonGreen-3xFLAG after the start codon.

Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.

  • Locus:
  • NAP1L1, Cre09.g416350
  • Chromosome:
  • 9

From George Witman, University of Massachusetts Medical School, January 2023

Background: CC-5415 nit1 agg1 mt+ [Witman g1]

Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.

Comment: This strain was one of the strains shown in Figures 8, 9, and 11 of Hou et al., (2022). The endogenous NAP1L1 allele was tagged with mNeonGreen-3xFLAG after the start codon.

Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.

  • Locus:
  • NAP1L1, Cre09.g416350
  • Chromosome:
  • 9

From Gui Zhang, Karl Lechtreck lab, University of Georgia, January 2023