Strains
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.
This is a ChR1 disruption strain with a point mutation E90R in ChR2, generated with SpCas9 nuclease.
Background strain: CC-125 mt+
Nuclease: SpCas9 nuclease
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: ChR1 TGTGGCTTCGTTACGCGGAG (exon 5); ChR2 CTATGTGTGCGCTATCGAGG (exon 4)
Marker: pAphVII (pPH360), pAphVIII (pPH114)
Mutation: E90R exchange in ChR2; insertion of short oligo TTTCGATTGAAGGAAAAGTTACAACGGAGT in ChR1
Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.
This is a ChR1 disruption strain with a point mutation E90Q in ChR2, generated with SpCas9 nuclease in CC-125 and crossed into CC-124.
Background strain: CC-124 mt-
Nuclease: SpCas9 nuclease
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: ChR1 TGTGGCTTCGTTACGCGGAG (exon 5);ChR2 CTATGTGTGCGCTATCGAGG (exon 4)
Mutation: E90R exchange in ChR2; insertion of short oligo TTTCGATTGAAGGAAAAGTTACAACGGAGT in ChR1
This is an unpublished strain. Please contact ph@chlamy.de before using it.
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, December 2022.
This is a ChR2 disruption strain with a point mutation E162T in ChR1, generated with SpCas9 nuclease in CC-125 and crossed into CC-124.
Background strain: CC-124 mt-
Nuclease: SpCas9 nuclease
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: ChR1 TGTGGCTTCGTTACGCGGAG (exon 5); ChR2 CTATGTGTGCGCTATCGAGG (exon 4)
Mutation: E162T exchange in ChR1; insertion of short oligo TTAGCTAAGCCTCCCCAAAGCCTGGCCAGGGTCTAG in ChR2
This is an unpublished strain. Please contact ph@chlamy.de before using it.
Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, December 2022
This is a ChR1 disruption strain with a point mutation E123T in ChR2, generated with Zif and SpCas9 nucleases.
Background strain: CC-3403
Nuclease: SpCas9 and Zif nucleases
Target gene: ChR2, Cre02.g085257
Target sequence: ChR2 AGTGGTTGCGTTACGCCGAG (exon 6)
Marker: pAphVIII (pPH114), pArg+ (pPH230)
Mutation: E123T exchange in ChR2
This is an unpublished strain. Please contact ph@chlamy.de before using it.
CC-5968 ∆SNRK2.2-C5 [PH158]
$30.00
$30.00
Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, December 2022
This is a SNRK2.2 (SAC3) disruption strain, generated with CRISPR/Cas9. Clone C5-A5.
Mutants with a disrupted SNRK2.2 (SAC3) gene show constitutive arylsulfatase expression and can phenotypically screened with X-SO4 dyes (see Kelterborn et al. 2022, doi.org/10.1007/978-1-0716-1791-5_3).
Background strain: SAG11-32b (=CC-409)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: SNRK2.2, Cre12.g499500
Target sequence: TAGCGAGGATGTCCAATCAG GGG (exon 1)
Mutation: insertion of short oligo (TTAGACTCTAACTAGATCAGcgg)
Overview of all CRISPR/Cas9 strains from the Hegemann lab: http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
CC-5969 ∆SNRK2.2-C10 [PH159]
$30.00
$30.00
Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, December 2022
This is a SNRK2.2 (SAC3) disruption strain, generated with CRISPR/Cas9. Clone C10-A10.
Mutants with a disrupted SNRK2.2 (SAC3) gene show constitutive arylsulfatase expression and can phenotypically screened with X-SO4 dyes (see Kelterborn et al. 2022, doi.org/10.1007/978-1-0716-1791-5_3).
Background strain: SAG11-32b (=CC-409)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: SNRK2.2, Cre12.g499500
Target sequence: TAGCGAGGATGTCCAATCAG GGG (exon 1)
Mutation: insertion of short oligo (TTAGACTCTAACTAGATCAGcgg)
Overview of all CRISPR/Cas9 strains from the Hegemann lab: http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
CC-5970 LF5HA16 mt+
$30.00
$30.00
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 6 and 7 of Hou et al., (2022). The endogenous LF5 allele was tagged with 3HA in front of the stop codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
CC-5971 LF5HA35 mt+
$30.00
$30.00
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 6 and 7 of Hou et al., (2022). The endogenous LF5 allele was tagged with 3HA in front of the stop codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
CC-5972 LF5HA41 mt+
$30.00
$30.00
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 6 and 7 of Hou et al., (2022). The endogenous LF5 allele was tagged with 3HA in front of the stop codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
CC-5973 LF5HA42 mt+
$30.00
$30.00
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 6 and 7 of Hou et al., (2022). The endogenous LF5 allele was tagged with 3HA in front of the stop codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
CC-5974 LF5HA49 mt+
$30.00
$30.00
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 6 and 7 of Hou et al., (2022). The endogenous LF5 allele was tagged with 3HA in front of the stop codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
CC-5975 LF5HA92 mt+
$30.00
$30.00
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 6 and 7 of Hou et al., (2022). The endogenous LF5 allele was tagged with 3HA in front of the stop codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
CC-5976 LF5HA94 mt+
$30.00
$30.00
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 6 and 7 of Hou et al., (2022). The endogenous LF5 allele was tagged with 3HA in front of the stop codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 8, 9, and 11 of Hou et al., (2022). The endogenous NAP1L1 allele was tagged with mNeonGreen-3xFLAG after the start codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 8, 9, and 11 of Hou et al., (2022). The endogenous NAP1L1 allele was tagged with mNeonGreen-3xFLAG after the start codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 8, 9, and 11 of Hou et al., (2022). The endogenous NAP1L1 allele was tagged with mNeonGreen-3xFLAG after the start codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 8, 9, and 11 of Hou et al., (2022). The endogenous NAP1L1 allele was tagged with mNeonGreen-3xFLAG after the start codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 8, 9, and 11 of Hou et al., (2022). The endogenous NAP1L1 allele was tagged with mNeonGreen-3xFLAG after the start codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 8, 9, and 11 of Hou et al., (2022). The endogenous NAP1L1 allele was tagged with mNeonGreen-3xFLAG after the start codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 8, 9, and 11 of Hou et al., (2022). The endogenous NAP1L1 allele was tagged with mNeonGreen-3xFLAG after the start codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 8, 9, and 11 of Hou et al., (2022). The endogenous NAP1L1 allele was tagged with mNeonGreen-3xFLAG after the start codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 8, 9, and 11 of Hou et al., (2022). The endogenous NAP1L1 allele was tagged with mNeonGreen-3xFLAG after the start codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 8, 9, and 11 of Hou et al., (2022). The endogenous NAP1L1 allele was tagged with mNeonGreen-3xFLAG after the start codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
From Gui Zhang, Karl Lechtreck lab, University of Georgia, January 2023
From Gui Zhang, Karl Lechtreck lab, University of Georgia, February 2023
CC-6005 dlu1-1 mt+ [#5a]
$30.00
$30.00
From Miho Sakato-Antoku, Stephen M King lab, University of Connecticut Health, May 2023
Phenotype: lacks outer arm dynein light chain LC1; paromomycin-resistant
This mutant was obtained by crossing dlu1-1 (LMJ.RY0402.223569) and wild type CC-125. It is designated as strain 5a in King lab.
Sakato-Antoku M, King SM. Outer-arm dynein light chain LC1 is required for normal motor assembly kinetics, ciliary stability, and motility. Mol Biol Cell. 2023 Jun 1;34(7):ar75. doi: 10.1091/mbc.E23-03-0104. Epub 2023 May 3. PMID: 37133971; PMCID: PMC10295483.
CC-6006 dlu1-1 LC1 [#R4]
$30.00
$30.00
From Miho Sakato-Antoku, Stephen M King lab, University of Connecticut Health, May 2023
Phenotype: unlike the background strain, it restores LC1 expression and does not require arginine to grow; paromomycin-resistant
It was created by transforming mutant dlu1-1 arg7-8 cw15 with pFA-LC1 plasmid containing LC1 and ARG7 expression cassettes in tandem. It is designated as strain R4 in King lab.
Sakato-Antoku M, King SM. Outer-arm dynein light chain LC1 is required for normal motor assembly kinetics, ciliary stability, and motility. Mol Biol Cell. 2023 Jun 1;34(7):ar75. doi: 10.1091/mbc.E23-03-0104. Epub 2023 May 3. PMID: 37133971; PMCID: PMC10295483.
CC-6007 dlu1-1 ida1 [#6c]
$30.00
$30.00
From Miho Sakato-Antoku, Stephen M King lab, University of Connecticut Health, May 2023
Phenotype: lacks outer arm dynein light chain LC1 and inner arm dynein I1/f; paromomycin-resistant; tends to form palmelloid cells
This mutant was obtained by crossing dlu1-1 (strain 5a, CC-6005) and ida1 (CC-2665). It is designated as strain 6c in King lab.
Kamiya R, Kurimoto E, Muto E. Two types of Chlamydomonas flagellar mutants missing different components of inner-arm dynein. J Cell Biol. 1991 Feb;112(3):441-7. doi: 10.1083/jcb.112.3.441. PMID: 1825085; PMCID: PMC2288841.
Sakato-Antoku M, King SM. Outer-arm dynein light chain LC1 is required for normal motor assembly kinetics, ciliary stability, and motility. Mol Biol Cell. 2023 Jun 1;34(7):ar75. doi: 10.1091/mbc.E23-03-0104. Epub 2023 May 3. PMID: 37133971; PMCID: PMC10295483.
CC-6008 dlu1-1 tpg1 [#28]
$30.00
$30.00
From Miho Sakato-Antoku, Stephen M King lab, University of Connecticut Health, May 2023
Phenotype: lacks outer arm dynein light chain LC1; reduced axonemal tubulin polyglutamylation; paromomycin-resistant; mixed population of immotile cells and cells showing twitchy motion or swimming
This mutant was obtained by crossing dlu1-1 (strain 5a, CC-6005) and tpg1 (CC-5245).
Kubo T, Yanagisawa HA, Yagi T, Hirono M, Kamiya R. Tubulin polyglutamylation regulates axonemal motility by modulating activities of inner-arm dyneins. Curr Biol. 2010 Mar 9;20(5):441-5. doi: 10.1016/j.cub.2009.12.058. Epub 2010 Feb 25. PMID: 20188560.
Sakato-Antoku M, King SM. Outer-arm dynein light chain LC1 is required for normal motor assembly kinetics, ciliary stability, and motility. Mol Biol Cell. 2023 Jun 1;34(7):ar75. doi: 10.1091/mbc.E23-03-0104. Epub 2023 May 3. PMID: 37133971; PMCID: PMC10295483.
CC-6009 oda2-t mt+ [#12c]
$30.00
$30.00
From Miho Sakato-Antoku, Stephen M King lab, University of Connecticut Health, May 2023
Phenotype: a truncation of the motor domain of outer arm dynein heavy chain γHC
This mutant was obtained by crossing CC-125 and oda2-t ida1 to eliminate an unknown mutation affecting cilia in CC-4439 in addition to oda2-t mutation. Please see Sakato-Antoku and King (2023) for details. It is designated as strain 12c in King lab.
Liu Z, Takazaki H, Nakazawa Y, Sakato M, Yagi T, Yasunaga T, King SM, Kamiya R. Partially functional outer-arm dynein in a novel Chlamydomonas mutant expressing a truncated gamma heavy chain. Eukaryot Cell. 2008 Jul;7(7):1136-45. doi: 10.1128/EC.00102-08. Epub 2008 May 16. PMID: 18487347; PMCID: PMC2446680.
Sakato-Antoku M, King SM. Outer-arm dynein light chain LC1 is required for normal motor assembly kinetics, ciliary stability, and motility. Mol Biol Cell. 2023 Jun 1;34(7):ar75. doi: 10.1091/mbc.E23-03-0104. Epub 2023 May 3. PMID: 37133971; PMCID: PMC10295483.