Strains
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023
This is a strain with a point mutation E90R in ChR2 and disrupted ChR1. The strain was generated with CRISPR/Cas9.
Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360); pAPHVIII (pPH75)
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); CTATGTGTGCGCTATCGAGG (ChR2)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023
This is a strain with a point mutation E162T in ChR1 and disrupted ChR2. The strain was generated with CRISPR/Cas9.
Background strain: CC-125 mt+, CC5959 (PH106)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360); pAPHVIII (pPH75); pCrZ3 (pPH68)
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); CTATGTGTGCGCTATCGAGG (ChR2)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is a published strain. Please cite it accordingly: Baidukova O., Oppermann J., Kelterborn S., Fernandez Lahore R.G., Schumacher D., Evers H., Kamrani Y.Y. and Hegemann P. (2022) Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat. Commun. 13, 7253. https://doi.org/10.1038/s41467-022-35018-6
Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023
This is a strain with a point mutation E162T in ChR1 and disrupted ChR2. The strain was generated with CRISPR/Cas9.
Background strain: CC-125 mt+, CC5959 (PH106)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360); pAPHVIII (pPH75); pCrZ3 (pPH68)
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); CTATGTGTGCGCTATCGAGG (ChR2)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is a published strain. Please cite it accordingly: Baidukova O., Oppermann J., Kelterborn S., Fernandez Lahore R.G., Schumacher D., Evers H., Kamrani Y.Y. and Hegemann P. (2022) Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat. Commun. 13, 7253. https://doi.org/10.1038/s41467-022-35018-6
Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023
This is a strain with a disrupted COP6 (HKR2). The strain was generated with CRISPR/Cas9.
Background strain: SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
Target gene: COP6 (HKR2), Cre11.g467678
Target sequence: GTTGTCTTCGAACAAGAGCG
Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
Deposited by Yousef Yari Kamrani and Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, July 2023
This is a FixL-like PAS domain protein disruption strain, generated with CRISPR/Cas9.
Background strain: ROC75-Luc+ (from Takuya Matsuo, see Niwa et al. 2013 for details)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
Target gene: Cre13.g587550
Target sequence:TCGGCTAAGGACAACGATGA TGG (Exon 1)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
From Saul Purton, University College London, August 2023
Origin: psbH::aadA knockout in which part of the psbH coding region and 3’ UTR is replaced with the aadA cassette through chloroplast transformation
Culture maintenance: Acetate-requiring, light-sensitive (ΔPSII mutant)
This strain was created to serve as a recipient for ‘marker-free’ chloroplast transformation where selection is based on restoration of phototrophy using the WT psbH gene as the marker. This strain has the same psbH::aadA genotype as strain TN72 (see: CC-5168) but was created using the cell-walled wild-type strain CC-1690 rather that a cell-wall deficient strain carrying the cw15 nuclear lesion. HT72 is therefore suitable for transformation using the microparticle bombardment method.
Wannathong T, Waterhouse JC, Young RE, Economou CK, Purton S. New tools for chloroplast genetic engineering allow the synthesis of human growth hormone in the green alga Chlamydomonas reinhardtii. Appl Microbiol Biotechnol. 2016 Jun;100(12):5467-77. doi: 10.1007/s00253-016-7354-6. Epub 2016 Feb 18. PMID: 26887319; PMCID: PMC4875957.
Larrea-Alvarez M, Young R, Purton S. A Simple Technology for Generating Marker-Free Chloroplast Transformants of the Green Alga Chlamydomonas reinhardtii. Methods Mol Biol. 2021;2317:293-304. doi: 10.1007/978-1-0716-1472-3_17. PMID: 34028777.
From Adrien Burlacot, Carnegie Institution for Science, August 2023
Origin: Electroporation with pAR-mtHSP70C-Clover-tPSAD, selected on hygromycin 20ug/mL
Culture maintenance: Low light
Algal CO2 capture is powered by alternative electron pathways of photosynthesis. Gilles Peltier, Carolyne Stoffel, Justin Findinier, Sai Kiran Madireddi, Ousmane Dao, Virginie Epting, Arthur Grossman, Yonghua Li-Beisson, Adrien Burlacot. bioRxiv 2023.08.08.552514; doi: https://doi.org/10.1101/2023.08.08.552514
From Adrien Burlacot, Carnegie Institution for Science, August 2023
Background: CC-5325
Origin: Electroporation with pAR-mtHSP70C-Clover-tPSAD, selected on hygromycin 20ug/mL
Culture maintenance: Low light
Chaux F, Burlacot A, Mekhalfi M, Auroy P, Blangy S, Richaud P, Peltier G. Flavodiiron Proteins Promote Fast and Transient O2 Photoreduction in Chlamydomonas. Plant Physiol. 2017 Jul;174(3):1825-1836. doi: 10.1104/pp.17.00421. Epub 2017 May 9. PMID: 28487478; PMCID: PMC5490913.
Algal CO2 capture is powered by alternative electron pathways of photosynthesis. Gilles Peltier, Carolyne Stoffel, Justin Findinier, Sai Kiran Madireddi, Ousmane Dao, Virginie Epting, Arthur Grossman, Yonghua Li-Beisson, Adrien Burlacot. bioRxiv 2023.08.08.552514; doi: https://doi.org/10.1101/2023.08.08.552514
From Adrien Burlacot, Carnegie Institution for Science, August 2023
Background: 137AH
Origin: Electroporation with pAR-mtHSP70C-Clover-tPSAD, selected on hygromycin 20ug/mL
Culture maintenance: Low light
Tolleter D, Ghysels B, Alric J, Petroutsos D, Tolstygina I, Krawietz D, Happe T, Auroy P, Adriano JM, Beyly A, Cuiné S, Plet J, Reiter IM, Genty B, Cournac L, Hippler M, Peltier G. Control of hydrogen photoproduction by the proton gradient generated by cyclic electron flow in Chlamydomonas reinhardtii. Plant Cell. 2011 Jul;23(7):2619-30. doi: 10.1105/tpc.111.086876. Epub 2011 Jul 15. PMID: 21764992; PMCID: PMC3226202.
Algal CO2 capture is powered by alternative electron pathways of photosynthesis. Gilles Peltier, Carolyne Stoffel, Justin Findinier, Sai Kiran Madireddi, Ousmane Dao, Virginie Epting, Arthur Grossman, Yonghua Li-Beisson, Adrien Burlacot. bioRxiv 2023.08.08.552514; doi: https://doi.org/10.1101/2023.08.08.552514
CC-6059 WT2 mito-Clover mt-
$30.00
$30.00
From Adrien Burlacot, Carnegie Institution for Science, August 2023
Background: flvB_21 crossed with pgrl1
Origin: Electroporation with pAR-mtHSP70C-Clover-tPSAD, selected on hygromycin 20ug/mL
Culture maintenance: Low light
Algal CO2 capture is powered by alternative electron pathways of photosynthesis. Gilles Peltier, Carolyne Stoffel, Justin Findinier, Sai Kiran Madireddi, Ousmane Dao, Virginie Epting, Arthur Grossman, Yonghua Li-Beisson, Adrien Burlacot. bioRxiv 2023.08.08.552514; doi: https://doi.org/10.1101/2023.08.08.552514
From Adrien Burlacot, Carnegie Institution for Science, August 2023
Background: flvB_21 crossed with pgrl1
Origin: Electroporation with pAR-mtHSP70C-Clover-tPSAD, selected on hygromycin 20ug/mL
Culture maintenance: Low light
Algal CO2 capture is powered by alternative electron pathways of photosynthesis. Gilles Peltier, Carolyne Stoffel, Justin Findinier, Sai Kiran Madireddi, Ousmane Dao, Virginie Epting, Arthur Grossman, Yonghua Li-Beisson, Adrien Burlacot. bioRxiv 2023.08.08.552514; doi: https://doi.org/10.1101/2023.08.08.552514
From Adrien Burlacot, Carnegie Institution for Science, August 2023
Background: flvB_21 crossed with pgrl1
Origin: Electroporation with pAR-mtHSP70C-Clover-tPSAD, selected on hygromycin 20ug/mL
Culture maintenance: Low light
Algal CO2 capture is powered by alternative electron pathways of photosynthesis. Gilles Peltier, Carolyne Stoffel, Justin Findinier, Sai Kiran Madireddi, Ousmane Dao, Virginie Epting, Arthur Grossman, Yonghua Li-Beisson, Adrien Burlacot. bioRxiv 2023.08.08.552514; doi: https://doi.org/10.1101/2023.08.08.552514
CC-6062 TUA1(WT)
$30.00
$30.00
From Tomohiro Kubo, University of Yamanashi-Japan, August 2023
Phenotype: Normal phenotype
Background: tua1(int1)
Origin: Generated by a CRISPR/Cas9 mediated gene editing; a paromomycin-resistant gene cassette was inserted into the intron 1 of TUA2 (Cre04.g216850); a hygromycin-resistant gene cassette was inserted into the region near 3’UTR of TUA1 (Cre03.g190950)
Kubo T, Tani Y, Yanagisawa HA, Kikkawa M, Oda T. α- and β-tubulin C-terminal tails with distinct modifications are crucial for ciliary motility and assembly. J Cell Sci. 2023 Aug 15;136(16):jcs261070. doi: 10.1242/jcs.261070. Epub 2023 Aug 17. PMID: 37519241.
CC-6063 TUA1(4A)
$30.00
$30.00
From Tomohiro Kubo, University of Yamanashi-Japan, August 2023
Phenotype: Lacks motility
Background: tua1(int1)
Origin: Generated by a CRISPR/Cas9 mediated gene editing; a paromomycin-resistant gene cassette was inserted into the intron 1 of TUA2 (Cre04.g216850); a hygromycin-resistant gene cassette was inserted into the region near 3’UTR of TUA1 (Cre03.g190950); four glutamate residues (E445, E447, E449, and E450) in TUA1 C-terminus region are all substituted to alanine
Kubo T, Tani Y, Yanagisawa HA, Kikkawa M, Oda T. α- and β-tubulin C-terminal tails with distinct modifications are crucial for ciliary motility and assembly. J Cell Sci. 2023 Aug 15;136(16):jcs261070. doi: 10.1242/jcs.261070. Epub 2023 Aug 17. PMID: 37519241.
CC-6064 tub1(int2)
$30.00
$30.00
From Tomohiro Kubo, University of Yamanashi-Japan, August 2023
Phenotype: Normal phenotype
Background: CC-124
Origin: Generated by a CRISPR/Cas9 mediated gene editing; a paromomycin-resistant gene cassette was inserted into the intron 2 of TUB1 (Cre12.g542250)
Kubo T, Tani Y, Yanagisawa HA, Kikkawa M, Oda T. α- and β-tubulin C-terminal tails with distinct modifications are crucial for ciliary motility and assembly. J Cell Sci. 2023 Aug 15;136(16):jcs261070. doi: 10.1242/jcs.261070. Epub 2023 Aug 17. PMID: 37519241.
CC-6065 TUB2(WT)
$30.00
$30.00
From Tomohiro Kubo, University of Yamanashi-Japan, August 2023
Phenotype: Normal phenotype
Background: tub1(int2)
Origin: Generated by a CRISPR/Cas9 mediated gene editing; a paromomycin-resistant gene cassette was inserted into the intron 2 of TUB1 (Cre12.g542250); a hygromycin-resistant gene cassette was inserted into the region near 3’UTR of TUB2 (Cre12.g549550)
Kubo T, Tani Y, Yanagisawa HA, Kikkawa M, Oda T. α- and β-tubulin C-terminal tails with distinct modifications are crucial for ciliary motility and assembly. J Cell Sci. 2023 Aug 15;136(16):jcs261070. doi: 10.1242/jcs.261070. Epub 2023 Aug 17. PMID: 37519241.
CC-6066 TUB2(Δ4E)
$30.00
$30.00
From Tomohiro Kubo, University of Yamanashi-Japan, August 2023
Phenotype: Impaired swimming motility
Background: tub1(int2)
Origin: Generated by a CRISPR/Cas9 mediated gene editing; a paromomycin-resistant gene cassette was inserted into the intron 2 of TUB1 (Cre12.g542250); a hygromycin-resistant gene cassette was inserted into the region near 3’UTR of TUB2 (Cre12.g549550); atop codon was inserted into TUB2 gene to eliminate four glutamate residues (E439, E440, E441, and E442) in the C-terminus region
Kubo T, Tani Y, Yanagisawa HA, Kikkawa M, Oda T. α- and β-tubulin C-terminal tails with distinct modifications are crucial for ciliary motility and assembly. J Cell Sci. 2023 Aug 15;136(16):jcs261070. doi: 10.1242/jcs.261070. Epub 2023 Aug 17. PMID: 37519241.
CC-6067 TUB2(Δ6E)
$30.00
$30.00
From Tomohiro Kubo, University of Yamanashi-Japan, August 2023
Phenotype: Impaired swimming motility with short flagella lacking the central-pair microtubules
Background: tub1(int2)
Origin: Generated by a CRISPR/Cas9 mediated gene editing; a paromomycin-resistant gene cassette was inserted into the intron 2 of TUB1 (Cre12.g542250); a hygromycin-resistant gene cassette was inserted into the region near 3’UTR of TUB2 (Cre12.g549550), a stop codon was inserted into TUB2 gene to eliminate six glutamate residues (E431, E432, E433, E439, E440, E441, and E442) in the C-terminus region
Kubo T, Tani Y, Yanagisawa HA, Kikkawa M, Oda T. α- and β-tubulin C-terminal tails with distinct modifications are crucial for ciliary motility and assembly. J Cell Sci. 2023 Aug 15;136(16):jcs261070. doi: 10.1242/jcs.261070. Epub 2023 Aug 17. PMID: 37519241.
CC-6068 fla3-2 mt+
$30.00
$30.00
From Gui Zhang, Karl Lechtreck lab, University of Georgia, November 2023
This strain, originally from George Witman and Yuqing Hou, is a kap null mutant generated in g1/CC-5415.
Lechtreck KF. Methods for Studying Movement of Molecules Within Cilia. Methods Mol Biol. 2016;1454:83-96. doi: 10.1007/978-1-4939-3789-9_6. PMID: 27514917; PMCID: PMC5269603.
Li S, Wan KY, Chen W, Tao H, Liang X, Pan J. Functional exploration of heterotrimeric kinesin-II in IFT and ciliary length control in Chlamydomonas. Elife. 2020 Oct 28;9:e58868. doi: 10.7554/eLife.58868. PMID: 33112235; PMCID: PMC7652414.
From Gui Zhang, Karl Lechtreck lab, University of Georgia, November 2023
This is kap null mutant was rescued with sfGFP-KAP (Patel et al.) in the pBR-2xsfGFP backbone (described in Lechtreck 2016) and is zeocin resistant.
Lechtreck KF. Methods for Studying Movement of Molecules Within Cilia. Methods Mol Biol. 2016;1454:83-96. doi: 10.1007/978-1-4939-3789-9_6. PMID: 27514917; PMCID: PMC5269603.
Li S, Wan KY, Chen W, Tao H, Liang X, Pan J. Functional exploration of heterotrimeric kinesin-II in IFT and ciliary length control in Chlamydomonas. Elife. 2020 Oct 28;9:e58868. doi: 10.7554/eLife.58868. PMID: 33112235; PMCID: PMC7652414.
From Gui Zhang, Karl Lechtreck lab, University of Georgia, November 2023
CC-1396 fla8 mt- was rescued with the FLA8-YFP construct described in Li et al. 2020 and is hygromycin resistant. Isolate A4.
Lechtreck KF. Methods for Studying Movement of Molecules Within Cilia. Methods Mol Biol. 2016;1454:83-96. doi: 10.1007/978-1-4939-3789-9_6. PMID: 27514917; PMCID: PMC5269603.
Li S, Wan KY, Chen W, Tao H, Liang X, Pan J. Functional exploration of heterotrimeric kinesin-II in IFT and ciliary length control in Chlamydomonas. Elife. 2020 Oct 28;9:e58868. doi: 10.7554/eLife.58868. PMID: 33112235; PMCID: PMC7652414.
From Gui Zhang, Karl Lechtreck lab, University of Georgia, November 2023
CC-1396 fla8 mt- was rescued with the FLA8-YFP construct described in Li et al. 2020 and is hygromycin resistant. Isolate A12.
Lechtreck KF. Methods for Studying Movement of Molecules Within Cilia. Methods Mol Biol. 2016;1454:83-96. doi: 10.1007/978-1-4939-3789-9_6. PMID: 27514917; PMCID: PMC5269603.
Li S, Wan KY, Chen W, Tao H, Liang X, Pan J. Functional exploration of heterotrimeric kinesin-II in IFT and ciliary length control in Chlamydomonas. Elife. 2020 Oct 28;9:e58868. doi: 10.7554/eLife.58868. PMID: 33112235; PMCID: PMC7652414.
CC-6072 pf23-2 mt-
$30.00
$30.00
From Gervette Penny, Susan Dutcher lab, Washington Univerity in St. Loius, November 2023
Genotype: pf23::aphVII; ac17; atg17::aphIII
Strain CC-5909 was transformed with aphVII construct targeted to exon 1 of the PF23 gene using CRISPR/Cas9.
This strain is a null allele of PF23. It lacks cilia under vegetative conditions and has extremetly short, stubby cilia as gametes. It does not grow in medium lacking acetate and is resistant to hygromycin and paromomycin.
Penny GM, Dutcher SK. Gene dosage of independent dynein arm motor preassembly factors influences cilia assembly in Chlamydomonas reinhardtii. PLoS Genet. 2024 Mar 18;20(3):e1011038. doi: 10.1371/journal.pgen.1011038. PMID: 38498551; PMCID: PMC11020789.
Payne ZL, Penny GM, Turner TN, Dutcher SK. A gap-free genome assembly of Chlamydomonas reinhardtii and detection of translocations induced by CRISPR-mediated mutagenesis. Plant Commun. 2023 Mar 13;4(2):100493. doi: 10.1016/j.xplc.2022.100493. Epub 2022 Nov 17. PMID: 36397679; PMCID: PMC10030371.
Lin H, Cliften PF, Dutcher SK. MAPINS, a Highly Efficient Detection Method That Identifies Insertional Mutations and Complex DNA Rearrangements. Plant Physiol. 2018 Dec;178(4):1436-1447. doi: 10.1104/pp.18.00474. Epub 2018 Sep 11. PMID: 30206105; PMCID: PMC6288735.
CC-6073 pf23-3 mt-
$30.00
$30.00
From Gervette Penny, Susan Dutcher lab, Washington Univerity in St. Loius, November 2023
Genotype: pf23::aphVII; ac17; atg17::aphIII
Strain CC-5909 was transformed with aphVII construct targeted to exon 1 of the PF23 gene using CRISPR/Cas9.
This strain is a null allele of PF23. It lacks cilia under vegetative conditions and has extremetly short, stubby cilia as gametes. It does not grow in medium lacking acetate and is resistant to hygromycin and paromomycin.
Penny GM, Dutcher SK. Gene dosage of independent dynein arm motor preassembly factors influences cilia assembly in Chlamydomonas reinhardtii. PLoS Genet. 2024 Mar 18;20(3):e1011038. doi: 10.1371/journal.pgen.1011038. PMID: 38498551; PMCID: PMC11020789.
Payne ZL, Penny GM, Turner TN, Dutcher SK. A gap-free genome assembly of Chlamydomonas reinhardtii and detection of translocations induced by CRISPR-mediated mutagenesis. Plant Commun. 2023 Mar 13;4(2):100493. doi: 10.1016/j.xplc.2022.100493. Epub 2022 Nov 17. PMID: 36397679; PMCID: PMC10030371.
Lin H, Cliften PF, Dutcher SK. MAPINS, a Highly Efficient Detection Method That Identifies Insertional Mutations and Complex DNA Rearrangements. Plant Physiol. 2018 Dec;178(4):1436-1447. doi: 10.1104/pp.18.00474. Epub 2018 Sep 11. PMID: 30206105; PMCID: PMC6288735.
CC-6074 pf23-4 mt+
$30.00
$30.00
From Gervette Penny, Susan Dutcher lab, Washington Univerity in St. Loius, November 2023
Genotype: pf23::aphVII; ac17; atg17::aphIII
Strain CC-5908 was transformed with aphVII construct targeted to exon 1 of the PF23 gene using CRISPR/Cas9.
This strain is a null allele of PF23. It lacks cilia under vegetative conditions and has extremetly short, stubby cilia as gametes. It does not grow in medium lacking acetate and is resistant to hygromycin and paromomycin.
Penny GM, Dutcher SK. Gene dosage of independent dynein arm motor preassembly factors influences cilia assembly in Chlamydomonas reinhardtii. PLoS Genet. 2024 Mar 18;20(3):e1011038. doi: 10.1371/journal.pgen.1011038. PMID: 38498551; PMCID: PMC11020789.
Payne ZL, Penny GM, Turner TN, Dutcher SK. A gap-free genome assembly of Chlamydomonas reinhardtii and detection of translocations induced by CRISPR-mediated mutagenesis. Plant Commun. 2023 Mar 13;4(2):100493. doi: 10.1016/j.xplc.2022.100493. Epub 2022 Nov 17. PMID: 36397679; PMCID: PMC10030371.
Lin H, Cliften PF, Dutcher SK. MAPINS, a Highly Efficient Detection Method That Identifies Insertional Mutations and Complex DNA Rearrangements. Plant Physiol. 2018 Dec;178(4):1436-1447. doi: 10.1104/pp.18.00474. Epub 2018 Sep 11. PMID: 30206105; PMCID: PMC6288735.
CC-6075 wt4-2P mt+
$30.00
$30.00
From Gervette Penny, Susan Dutcher lab, Washington Univerity in St. Loius, November 2023
New wild-type strain generated from multiple crosses of CC-124 and CC-125.
Penny GM, Dutcher SK. Gene dosage of independent dynein arm motor preassembly factors influences cilia assembly in Chlamydomonas reinhardtii. PLoS Genet. 2024 Mar 18;20(3):e1011038. doi: 10.1371/journal.pgen.1011038. PMID: 38498551; PMCID: PMC11020789.
CC-6076 cnk11-3 mt-
$30.00
$30.00
From Gervette Penny, Susan Dutcher lab, Washington Univerity in St. Loius, November 2023
This mutant is a progeny from a cross between pf23-4 and cnk11-3. Motility resembles wild-type.
Penny GM, Dutcher SK. Gene dosage of independent dynein arm motor preassembly factors influences cilia assembly in Chlamydomonas reinhardtii. PLoS Genet. 2024 Mar 18;20(3):e1011038. doi: 10.1371/journal.pgen.1011038. PMID: 38498551; PMCID: PMC11020789.
Lin H, Zhang Z, Guo S, Chen F, Kessler JM, Wang YM, Dutcher SK. A NIMA-Related Kinase Suppresses the Flagellar Instability Associated with the Loss of Multiple Axonemal Structures. PLoS Genet. 2015 Sep 8;11(9):e1005508. doi: 10.1371/journal.pgen.1005508. PMID: 26348919; PMCID: PMC4562644.
CC-6077 cnk11-3 mt+
$30.00
$30.00
From Gervette Penny, Susan Dutcher lab, Washington Univerity in St. Loius, November 2023
This mutant is a progeny from a cross between pf23-4 and cnk11-3. Motility resembles wild-type.
Penny GM, Dutcher SK. Gene dosage of independent dynein arm motor preassembly factors influences cilia assembly in Chlamydomonas reinhardtii. PLoS Genet. 2024 Mar 18;20(3):e1011038. doi: 10.1371/journal.pgen.1011038. PMID: 38498551; PMCID: PMC11020789.
Lin H, Zhang Z, Guo S, Chen F, Kessler JM, Wang YM, Dutcher SK. A NIMA-Related Kinase Suppresses the Flagellar Instability Associated with the Loss of Multiple Axonemal Structures. PLoS Genet. 2015 Sep 8;11(9):e1005508. doi: 10.1371/journal.pgen.1005508. PMID: 26348919; PMCID: PMC4562644.
CC-6078 pf23-4; cnk11-3 mt+
$30.00
$30.00
From Gervette Penny, Susan Dutcher lab, Washington Univerity in St. Loius, November 2023
This mutant is acilliate or has short, stubby cilia and is resistant to hygromycin.
Penny GM, Dutcher SK. Gene dosage of independent dynein arm motor preassembly factors influences cilia assembly in Chlamydomonas reinhardtii. PLoS Genet. 2024 Mar 18;20(3):e1011038. doi: 10.1371/journal.pgen.1011038. PMID: 38498551; PMCID: PMC11020789.
Lin H, Zhang Z, Guo S, Chen F, Kessler JM, Wang YM, Dutcher SK. A NIMA-Related Kinase Suppresses the Flagellar Instability Associated with the Loss of Multiple Axonemal Structures. PLoS Genet. 2015 Sep 8;11(9):e1005508. doi: 10.1371/journal.pgen.1005508. PMID: 26348919; PMCID: PMC4562644.
CC-6079 pf23-4; cnk11-3 mt-
$30.00
$30.00
From Gervette Penny, Susan Dutcher lab, Washington Univerity in St. Loius, November 2023
This mutant is acilliate or has short, stubby cilia and is resistant to hygromycin.
Penny GM, Dutcher SK. Gene dosage of independent dynein arm motor preassembly factors influences cilia assembly in Chlamydomonas reinhardtii. PLoS Genet. 2024 Mar 18;20(3):e1011038. doi: 10.1371/journal.pgen.1011038. PMID: 38498551; PMCID: PMC11020789.
Lin H, Zhang Z, Guo S, Chen F, Kessler JM, Wang YM, Dutcher SK. A NIMA-Related Kinase Suppresses the Flagellar Instability Associated with the Loss of Multiple Axonemal Structures. PLoS Genet. 2015 Sep 8;11(9):e1005508. doi: 10.1371/journal.pgen.1005508. PMID: 26348919; PMCID: PMC4562644.