Strains
From Adrian Nievergelt, Max-Planck-Institute for Molecular Cell Biology and Genetics (MPI-CBG), Dresden, Germany, August 2023
Background: CC-124 32M
Origin: Co-targeted CRISPR mediated endogenous n-terminal mNeonGreen with introns + DRC4::AphVIII insertion
Proof of concept strain for cotargeted genome editing with region replacement by multiple guide RNAs. The expression of fluorescent tubulin is visible in a confocal microscope, but very expression is unusually low. Resistant to Paromomycin.
Nievergelt AP, Diener DR, Bogdanova A, Brown T, Pigino G. Efficient precision editing of endogenous Chlamydomonas reinhardtii genes with CRISPR-Cas. Cell Rep Methods. 2023 Aug 22;3(8):100562. doi: 10.1016/j.crmeth.2023.100562. PMID: 37671018; PMCID: PMC10475843.
CC-6017 FAP256-mNeonGreen
$30.00
$30.00
From Adrian Nievergelt, Max-Planck-Institute for Molecular Cell Biology and Genetics (MPI-CBG), Dresden, Germany, August 2023
Background: CC-124 32M
Origin: CRISPR mediated endogenous c-terminal mNeonGreen fusion
This strain has bright fluorescent ciliary tips as well as zones of fluorescence clost to the ciliary base. Resistant to Nourseothricin.
Nievergelt AP, Diener DR, Bogdanova A, Brown T, Pigino G. Efficient precision editing of endogenous Chlamydomonas reinhardtii genes with CRISPR-Cas. Cell Rep Methods. 2023 Aug 22;3(8):100562. doi: 10.1016/j.crmeth.2023.100562. PMID: 37671018; PMCID: PMC10475843.
From Adrian Nievergelt, Max-Planck-Institute for Molecular Cell Biology and Genetics (MPI-CBG), Dresden, Germany, August 2023
Background: CC-4375
Origin: Insertional rescue of IFT46::NIT
Red fluorescent label for IFT, but less bright than CC-6014/CC-6015. Resistant to Paromomycin.
Nievergelt AP, Diener DR, Bogdanova A, Brown T, Pigino G. Efficient precision editing of endogenous Chlamydomonas reinhardtii genes with CRISPR-Cas. Cell Rep Methods. 2023 Aug 22;3(8):100562. doi: 10.1016/j.crmeth.2023.100562. PMID: 37671018; PMCID: PMC10475843.
From Adrian Nievergelt, Max-Planck-Institute for Molecular Cell Biology and Genetics (MPI-CBG), Dresden, Germany, August 2023
Background: CC-124 32M/CC-4375
Origin: Cross between CC-6017 and CC-6018
This strain has bright green fluorescent ciliary tips as well as zones of green fluorescence clost to the ciliary base and red fluorescent IFT. Resistant to Nourseothricin and Paromomycin.
Nievergelt AP, Diener DR, Bogdanova A, Brown T, Pigino G. Efficient precision editing of endogenous Chlamydomonas reinhardtii genes with CRISPR-Cas. Cell Rep Methods. 2023 Aug 22;3(8):100562. doi: 10.1016/j.crmeth.2023.100562. PMID: 37671018; PMCID: PMC10475843.
From Chun Sing Lau, Mackinder lab, University of York, July 2023
This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of RBCS2 (Cre02.g120150) as a fusion protein with a C-terminal TurboID and 3xHA tag using the PSAD promoter/terminator pair. The strain carries resistance to hygromycin.
Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.
From Chun Sing Lau, Mackinder lab, University of York, July 2023
This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of RPE1 (Cre12.g511900) as a fusion protein with a C-terminal TurboID and 3xHA tag using the PSAD promoter/terminator pair. The strain carries resistance to paromomycin.
Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.
From Chun Sing Lau, Mackinder lab, University of York, July 2023
This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of PRK1 (Cre12.g554800) as a fusion protein with a C-terminal TurboID and 3xHA tag using the PSAD promoter/terminator pair. The strain carries resistance to paromomycin.
Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.
From Chun Sing Lau, Mackinder lab, University of York, July 2023
This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of EPYC1 (Cre10.g436550) as a fusion protein with a C-terminal TurboID and 3xHA tag using the PSAD promoter/terminator pair. The strain carries resistance to paromomycin.
Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.
From Chun Sing Lau, Mackinder lab, University of York, July 2023
This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of RBCS2 (Cre02.g120150) as a fusion protein with a C-terminal TurboID and mCherry tag using the PSAD promoter/terminator pair. The strain carries resistance to hygromycin.
Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.
From Chun Sing Lau, Mackinder lab, University of York, July 2023
This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of RPE1 (Cre12.g511900) as a fusion protein with a C-terminal TurboID and mCherry tag using the PSAD promoter/terminator pair. The strain carries resistance to paromomycin.
Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.
From Chun Sing Lau, Mackinder lab, University of York, July 2023
This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of PRK1 (Cre12.g554800) as a fusion protein with a C-terminal TurboID and mCherry using the PSAD promoter/terminator pair. The strain carries resistance to paromomycin.
Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.
From Chun Sing Lau, Mackinder lab, University of York, July 2023
This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of EPYC1 (Cre10.g436550) as a fusion protein with a C-terminal TurboID and 3xHA tag using the PSAD promoter/terminator pair. The strain carries resistance to paromomycin.
Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.
From Chun Sing Lau, Mackinder lab, University of York, July 2023
This strain was obtained by transformation of the epyc1 mutant (https://doi.org/10.1073/pnas.1522866113) using a plasmid which drives expression of RBCS2 (Cre02.g120150) as a fusion protein with a C-terminal TurboID and 3xHA tag using the PSAD promoter/terminator pair. The strain carries resistance to both hygromycin and paromomycin resistance.
Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.
From Chun Sing Lau, Mackinder lab, University of York, July 2023
This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of RBCS2 (Cre02.g120150) as a fusion protein with a C-terminal APEX2 and 3xFlag tag using the PSAD promoter/terminator pair. The strain carries resistance to hygromycin.
Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.
From Chun Sing Lau, Mackinder lab, University of York, July 2023
This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of STR16 (Cre13.g573250) as a fusion protein with a C-terminal mScarlet-I and 3xFlag tag using its native promoter. The strain carries resistance to hygromycin.
Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.
From Chun Sing Lau, Mackinder lab, University of York, July 2023
This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of STR18 (Cre16.g663150) as a fusion protein with a C-terminal Venus and 3xFlag tag using its native promoter. The strain carries resistance to paromomycin.
Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.
From Chun Sing Lau, Mackinder lab, University of York, July 2023
This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of protein encoded by Cre09.g394510 as a fusion protein with a C-terminal Venus and 3xFlag tag using its native promoter. The strain carries resistance to paromomycin.
Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.
From Chun Sing Lau, Mackinder lab, University of York, July 2023
This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of ABCF6 (Cre06.g271850) as a fusion protein with a C-terminal Venus and 3xFlag tag using its native promoter. The strain carries resistance to paromomycin.
Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.
From Chun Sing Lau, Mackinder lab, University of York, July 2023
This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of protein encoded by Cre03.g172700 as a fusion protein with a C-terminal Venus and 3xFlag tag using its native promoter. The strain carries resistance to paromomycin.
Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.
From Chun Sing Lau, Mackinder lab, University of York, July 2023
This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of SMC7 (Cre17.g720450) as a fusion protein with a C-terminal Venus and 3xFlag tag using its native promoter. The strain carries resistance to paromomycin.
Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.
From Chun Sing Lau, Mackinder lab, University of York, July 2023
This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of protein encoded by Cre02.g093650 as a fusion protein with a C-terminal Venus and 3xFlag tag using its native promoter. The strain carries resistance to paromomycin.
Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023
This is a strain with a point mutation E90R in ChR2 and disrupted ChR1. The strain was generated with CRISPR/Cas9.
Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360); pAPHVIII (pPH75)
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); CTATGTGTGCGCTATCGAGG (ChR2)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is a published strain. Please cite it accordingly: Baidukova O., Oppermann J., Kelterborn S., Fernandez Lahore R.G., Schumacher D., Evers H., Kamrani Y.Y. and Hegemann P. (2022) Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat. Commun. 13, 7253. https://doi.org/10.1038/s41467-022-35018-6
Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023
This is a strain with a point mutation E90R in ChR2 and disrupted ChR1. The strain was generated with CRISPR/Cas9.
Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360); pAPHVIII (pPH75)
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); CTATGTGTGCGCTATCGAGG (ChR2)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is a published strain. Please cite it accordingly: Baidukova O., Oppermann J., Kelterborn S., Fernandez Lahore R.G., Schumacher D., Evers H., Kamrani Y.Y. and Hegemann P. (2022) Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat. Commun. 13, 7253. https://doi.org/10.1038/s41467-022-35018-6
Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023
This is a strain with a point mutation E90Q in ChR2 and disrupted ChR1, which was generated with CRISPR/Cas9. The original strain PH198 with CC125 as a background was crossed into CC124.
Background strain: PH198, CC124 mt-
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); CTATGTGTGCGCTATCGAGG (ChR2)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023
This is a strain with a point mutation E162T in ChR1 and disrupted ChR2, which was generated with CRISPR/Cas9. The original strain PH180 with CC125 as a background was crossed into CC124.
Background strain: CC124 mt-, PH180
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); CTATGTGTGCGCTATCGAGG (ChR2)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023
This is a strain with a point mutation E90Q in ChR2 and disrupted ChR1. The strain was generated with CRISPR/Cas9.
Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360); pAPHVIII (pPH75)
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); CTATGTGTGCGCTATCGAGG (ChR2)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is a published strain. Please cite it accordingly: Baidukova O., Oppermann J., Kelterborn S., Fernandez Lahore R.G., Schumacher D., Evers H., Kamrani Y.Y. and Hegemann P. (2022) Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat. Commun. 13, 7253. https://doi.org/10.1038/s41467-022-35018-6
Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023
This is a strain with a point mutation K93S in ChR2 and disrupted ChR1. The strain was generated with CRISPR/Cas9.
Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360); pAPHVIII (pPH75)
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); GACCCGAACGCAGATGGTCA (ChR2)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
Deposited by Simon Kelterborn and Franzisca Bohning, Peter Hegemann lab, Humboldt University-Berlin, July 2023
This is a strain with a point mutation E123T in ChR2 and disrupted ChR1. The strain was generated with CRISPR/Cas9.
Background strain: CC-3403 mt-
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360); pAPHVIII (pPH75)
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); AGTGGTTGCGTTACGCCGAG (ChR2)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023
This is a strain with a point mutation E123T in ChR2 and disrupted ChR1. The strain was generated with CRISPR/Cas9.
Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360); pAPHVIII (pPH75)
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); AGTGGTTGCGTTACGCCGAG (ChR2)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is a published strain. Please cite it accordingly: Baidukova O., Oppermann J., Kelterborn S., Fernandez Lahore R.G., Schumacher D., Evers H., Kamrani Y.Y. and Hegemann P. (2022) Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat. Commun. 13, 7253. https://doi.org/10.1038/s41467-022-35018-6
Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023
This is a strain with a point mutation E123T in ChR2 and disrupted ChR1. The strain was generated with CRISPR/Cas9.
Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360); pAPHVIII (pPH75)
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); AGTGGTTGCGTTACGCCGAG (ChR2)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is a published strain. Please cite it accordingly: Baidukova O., Oppermann J., Kelterborn S., Fernandez Lahore R.G., Schumacher D., Evers H., Kamrani Y.Y. and Hegemann P. (2022) Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat. Commun. 13, 7253. https://doi.org/10.1038/s41467-022-35018-6
Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.
- «Previous Page
- 1
- …
- 123
- 124
- 125
- 126
- 127
- …
- 129
- Next Page»