Strains
CC-5968 ∆SNRK2.2-C5 [PH158]
$30.00
$30.00
Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, December 2022
This is a SNRK2.2 (SAC3) disruption strain, generated with CRISPR/Cas9. Clone C5-A5.
Mutants with a disrupted SNRK2.2 (SAC3) gene show constitutive arylsulfatase expression and can phenotypically screened with X-SO4 dyes (see Kelterborn et al. 2022, doi.org/10.1007/978-1-0716-1791-5_3).
Background strain: SAG11-32b (=CC-409)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: SNRK2.2, Cre12.g499500
Target sequence: TAGCGAGGATGTCCAATCAG GGG (exon 1)
Mutation: insertion of short oligo (TTAGACTCTAACTAGATCAGcgg)
Overview of all CRISPR/Cas9 strains from the Hegemann lab: http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
CC-5969 ∆SNRK2.2-C10 [PH159]
$30.00
$30.00
Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, December 2022
This is a SNRK2.2 (SAC3) disruption strain, generated with CRISPR/Cas9. Clone C10-A10.
Mutants with a disrupted SNRK2.2 (SAC3) gene show constitutive arylsulfatase expression and can phenotypically screened with X-SO4 dyes (see Kelterborn et al. 2022, doi.org/10.1007/978-1-0716-1791-5_3).
Background strain: SAG11-32b (=CC-409)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: SNRK2.2, Cre12.g499500
Target sequence: TAGCGAGGATGTCCAATCAG GGG (exon 1)
Mutation: insertion of short oligo (TTAGACTCTAACTAGATCAGcgg)
Overview of all CRISPR/Cas9 strains from the Hegemann lab: http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
CC-5970 LF5HA16 mt+
$30.00
$30.00
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 6 and 7 of Hou et al., (2022). The endogenous LF5 allele was tagged with 3HA in front of the stop codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
CC-5971 LF5HA35 mt+
$30.00
$30.00
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 6 and 7 of Hou et al., (2022). The endogenous LF5 allele was tagged with 3HA in front of the stop codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
CC-5972 LF5HA41 mt+
$30.00
$30.00
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 6 and 7 of Hou et al., (2022). The endogenous LF5 allele was tagged with 3HA in front of the stop codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
CC-5973 LF5HA42 mt+
$30.00
$30.00
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 6 and 7 of Hou et al., (2022). The endogenous LF5 allele was tagged with 3HA in front of the stop codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
CC-5974 LF5HA49 mt+
$30.00
$30.00
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 6 and 7 of Hou et al., (2022). The endogenous LF5 allele was tagged with 3HA in front of the stop codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
CC-5975 LF5HA92 mt+
$30.00
$30.00
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 6 and 7 of Hou et al., (2022). The endogenous LF5 allele was tagged with 3HA in front of the stop codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
CC-5976 LF5HA94 mt+
$30.00
$30.00
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 6 and 7 of Hou et al., (2022). The endogenous LF5 allele was tagged with 3HA in front of the stop codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 8, 9, and 11 of Hou et al., (2022). The endogenous NAP1L1 allele was tagged with mNeonGreen-3xFLAG after the start codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 8, 9, and 11 of Hou et al., (2022). The endogenous NAP1L1 allele was tagged with mNeonGreen-3xFLAG after the start codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 8, 9, and 11 of Hou et al., (2022). The endogenous NAP1L1 allele was tagged with mNeonGreen-3xFLAG after the start codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 8, 9, and 11 of Hou et al., (2022). The endogenous NAP1L1 allele was tagged with mNeonGreen-3xFLAG after the start codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 8, 9, and 11 of Hou et al., (2022). The endogenous NAP1L1 allele was tagged with mNeonGreen-3xFLAG after the start codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 8, 9, and 11 of Hou et al., (2022). The endogenous NAP1L1 allele was tagged with mNeonGreen-3xFLAG after the start codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 8, 9, and 11 of Hou et al., (2022). The endogenous NAP1L1 allele was tagged with mNeonGreen-3xFLAG after the start codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 8, 9, and 11 of Hou et al., (2022). The endogenous NAP1L1 allele was tagged with mNeonGreen-3xFLAG after the start codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 8, 9, and 11 of Hou et al., (2022). The endogenous NAP1L1 allele was tagged with mNeonGreen-3xFLAG after the start codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
From George Witman, University of Massachusetts Medical School, January 2023
Background: CC-5415 nit1 agg1 mt+ [Witman g1]
Origin: This strain was generated by the TIM-tagging method, a direct in situ tagging method based on TIM, targeted insertional mutagenesis.
Comment: This strain was one of the strains shown in Figures 8, 9, and 11 of Hou et al., (2022). The endogenous NAP1L1 allele was tagged with mNeonGreen-3xFLAG after the start codon.
Hou Y, Cheng X, Witman GB. Direct in situ protein tagging in Chlamydomonas reinhardtii utilizing TIM, a method for CRISPR/Cas9-based targeted insertional mutagenesis. PLoS One. 2022 Dec 9;17(12):e0278972. doi: 10.1371/journal.pone.0278972. PMID: 36490276; PMCID: PMC9733891.
From Gui Zhang, Karl Lechtreck lab, University of Georgia, January 2023
This strain expressing two fusion proteins tagged to a different fluorescent protein was generated by a cross of pf14::RSP3-NeonGreen and armc2::ARMC2-Sca. It was selected for motility and fluorescence of both mNeonGreen and mScarlet-I. Bright fluorescence suggests that the transgenes were expressed in pf14 armc2.
Lechtreck KF, Liu Y, Dai J, Alkhofash RA, Butler J, Alford L, Yang P. Chlamydomonas ARMC2/PF27 is an obligate cargo adapter for intraflagellar transport of radial spokes. Elife. 2022 Jan 4;11:e74993. doi: 10.7554/eLife.74993. PMID: 34982025; PMCID: PMC8789290.
CC-5989 sip; pkd2 mt+
$30.00
$30.00
From Gui Zhang, Karl Lechtreck lab, University of Georgia, February 2023
This strain was made by crossing pkd2 mt+ (generated by out-crossing pkd2 from CLiP strain LMJ.RY0402.204581 to Pazour strain g1) with a mt- sip CLiP mutant (LMJ.RY0402.143879). This strain is resistant to hygromycin.
Das P, Mekonnen B, Alkhofash R, Ingle AV, Workman EB, Feather A, Zhang G, Chasen N, Liu P, Lechtreck KF. The Small Interactor of PKD2 protein promotes the assembly and ciliary entry of the Chlamydomonas PKD2-mastigoneme complexes. J Cell Sci. 2024 Jan 1;137(1):jcs261497. doi: 10.1242/jcs.261497. Epub 2024 Jan 12. PMID: 38063216; PMCID: PMC10846610.
CC-5990 mst1; pkd2
$30.00
$30.00
From Gui Zhang, Karl Lechtreck lab, University of Georgia, February 2023
This strain was generated by mating pkd2 mt+ to mst1 mt- (CLiP LMJ.RY0402.052413).
Liu P, Lou X, Wingfield JL, Lin J, Nicastro D, Lechtreck K. Chlamydomonas PKD2 organizes mastigonemes, hair-like glycoprotein polymers on cilia. J Cell Biol. 2020 Jun 1;219(6):e202001122. doi: 10.1083/jcb.202001122. PMID: 32348466; PMCID: PMC7265326.
From Gui Zhang, Karl Lechtreck lab, University of Georgia, February 2023
This strain was obtained by mating oda3 oda6::IC2-NG and ift20::IFT20-mCherry. The outer dynein arms (ODAs) are tagged on the essential IC2 subunits with mNeonGreen and IFT is visible by IFT20-mCherry expression. ODAs do not assemble in cilia due to the absence of the docking complex in oda3. This allows imaging of ODA transport and IFT.
.
Dai J, Barbieri F, Mitchell DR, Lechtreck KF. In vivo analysis of outer arm dynein transport reveals cargo-specific intraflagellar transport properties. Mol Biol Cell. 2018 Oct 15;29(21):2553-2565. doi: 10.1091/mbc.E18-05-0291. Epub 2018 Aug 22. PMID: 30133350; PMCID: PMC6254574.
CC-6005 dlu1-1 mt+ [#5a]
$30.00
$30.00
From Miho Sakato-Antoku, Stephen M King lab, University of Connecticut Health, May 2023
Phenotype: lacks outer arm dynein light chain LC1; paromomycin-resistant
This mutant was obtained by crossing dlu1-1 (LMJ.RY0402.223569) and wild type CC-125. It is designated as strain 5a in King lab.
Sakato-Antoku M, King SM. Outer-arm dynein light chain LC1 is required for normal motor assembly kinetics, ciliary stability, and motility. Mol Biol Cell. 2023 Jun 1;34(7):ar75. doi: 10.1091/mbc.E23-03-0104. Epub 2023 May 3. PMID: 37133971; PMCID: PMC10295483.
CC-6006 dlu1-1 LC1 [#R4]
$30.00
$30.00
From Miho Sakato-Antoku, Stephen M King lab, University of Connecticut Health, May 2023
Phenotype: unlike the background strain, it restores LC1 expression and does not require arginine to grow; paromomycin-resistant
It was created by transforming mutant dlu1-1 arg7-8 cw15 with pFA-LC1 plasmid containing LC1 and ARG7 expression cassettes in tandem. It is designated as strain R4 in King lab.
Sakato-Antoku M, King SM. Outer-arm dynein light chain LC1 is required for normal motor assembly kinetics, ciliary stability, and motility. Mol Biol Cell. 2023 Jun 1;34(7):ar75. doi: 10.1091/mbc.E23-03-0104. Epub 2023 May 3. PMID: 37133971; PMCID: PMC10295483.
CC-6007 dlu1-1 ida1 [#6c]
$30.00
$30.00
From Miho Sakato-Antoku, Stephen M King lab, University of Connecticut Health, May 2023
Phenotype: lacks outer arm dynein light chain LC1 and inner arm dynein I1/f; paromomycin-resistant; tends to form palmelloid cells
This mutant was obtained by crossing dlu1-1 (strain 5a, CC-6005) and ida1 (CC-2665). It is designated as strain 6c in King lab.
Kamiya R, Kurimoto E, Muto E. Two types of Chlamydomonas flagellar mutants missing different components of inner-arm dynein. J Cell Biol. 1991 Feb;112(3):441-7. doi: 10.1083/jcb.112.3.441. PMID: 1825085; PMCID: PMC2288841.
Sakato-Antoku M, King SM. Outer-arm dynein light chain LC1 is required for normal motor assembly kinetics, ciliary stability, and motility. Mol Biol Cell. 2023 Jun 1;34(7):ar75. doi: 10.1091/mbc.E23-03-0104. Epub 2023 May 3. PMID: 37133971; PMCID: PMC10295483.
CC-6008 dlu1-1 tpg1 [#28]
$30.00
$30.00
From Miho Sakato-Antoku, Stephen M King lab, University of Connecticut Health, May 2023
Phenotype: lacks outer arm dynein light chain LC1; reduced axonemal tubulin polyglutamylation; paromomycin-resistant; mixed population of immotile cells and cells showing twitchy motion or swimming
This mutant was obtained by crossing dlu1-1 (strain 5a, CC-6005) and tpg1 (CC-5245).
Kubo T, Yanagisawa HA, Yagi T, Hirono M, Kamiya R. Tubulin polyglutamylation regulates axonemal motility by modulating activities of inner-arm dyneins. Curr Biol. 2010 Mar 9;20(5):441-5. doi: 10.1016/j.cub.2009.12.058. Epub 2010 Feb 25. PMID: 20188560.
Sakato-Antoku M, King SM. Outer-arm dynein light chain LC1 is required for normal motor assembly kinetics, ciliary stability, and motility. Mol Biol Cell. 2023 Jun 1;34(7):ar75. doi: 10.1091/mbc.E23-03-0104. Epub 2023 May 3. PMID: 37133971; PMCID: PMC10295483.
CC-6009 oda2-t mt+ [#12c]
$30.00
$30.00
From Miho Sakato-Antoku, Stephen M King lab, University of Connecticut Health, May 2023
Phenotype: a truncation of the motor domain of outer arm dynein heavy chain γHC
This mutant was obtained by crossing CC-125 and oda2-t ida1 to eliminate an unknown mutation affecting cilia in CC-4439 in addition to oda2-t mutation. Please see Sakato-Antoku and King (2023) for details. It is designated as strain 12c in King lab.
Liu Z, Takazaki H, Nakazawa Y, Sakato M, Yagi T, Yasunaga T, King SM, Kamiya R. Partially functional outer-arm dynein in a novel Chlamydomonas mutant expressing a truncated gamma heavy chain. Eukaryot Cell. 2008 Jul;7(7):1136-45. doi: 10.1128/EC.00102-08. Epub 2008 May 16. PMID: 18487347; PMCID: PMC2446680.
Sakato-Antoku M, King SM. Outer-arm dynein light chain LC1 is required for normal motor assembly kinetics, ciliary stability, and motility. Mol Biol Cell. 2023 Jun 1;34(7):ar75. doi: 10.1091/mbc.E23-03-0104. Epub 2023 May 3. PMID: 37133971; PMCID: PMC10295483.
From Miho Sakato-Antoku, Stephen M King lab, University of Connecticut Health, May 2023
Phenotype: a truncation of the motor domain of outer arm dynein heavy chain γHC; lacks inner arm dynein I1/f; tends to form palmelloid cells
This mutant was obtained by crossing oda2-t (strain 12c, CC-6009) and ida1 (CC-2665). It is designated as strain 12c-1b in King lab.
Kamiya R, Kurimoto E, Muto E. Two types of Chlamydomonas flagellar mutants missing different components of inner-arm dynein. J Cell Biol. 1991 Feb;112(3):441-7. doi: 10.1083/jcb.112.3.441. PMID: 1825085; PMCID: PMC2288841.
Liu Z, Takazaki H, Nakazawa Y, Sakato M, Yagi T, Yasunaga T, King SM, Kamiya R. Partially functional outer-arm dynein in a novel Chlamydomonas mutant expressing a truncated gamma heavy chain. Eukaryot Cell. 2008 Jul;7(7):1136-45. doi: 10.1128/EC.00102-08. Epub 2008 May 16. PMID: 18487347; PMCID: PMC2446680.
Sakato-Antoku M, King SM. Outer-arm dynein light chain LC1 is required for normal motor assembly kinetics, ciliary stability, and motility. Mol Biol Cell. 2023 Jun 1;34(7):ar75. doi: 10.1091/mbc.E23-03-0104. Epub 2023 May 3. PMID: 37133971; PMCID: PMC10295483.
CC-6011 oda2-t tpg1 [#2]
$30.00
$30.00
From Miho Sakato-Antoku, Stephen M King lab, University of Connecticut Health, May 2023
Phenotype: a truncation of the motor domain of outer arm dynein heavy chain γHC; reduced axonemal tubulin polyglutamylation; mixed population of immotile cells and cells showing intermittent beating or swimming
This mutant was obtained by crossing oda2-t (strain 12c, CC-6009) and tpg1 (CC-5245).
Liu Z, Takazaki H, Nakazawa Y, Sakato M, Yagi T, Yasunaga T, King SM, Kamiya R. Partially functional outer-arm dynein in a novel Chlamydomonas mutant expressing a truncated gamma heavy chain. Eukaryot Cell. 2008 Jul;7(7):1136-45. doi: 10.1128/EC.00102-08. Epub 2008 May 16. PMID: 18487347; PMCID: PMC2446680.
Kubo T, Yanagisawa HA, Yagi T, Hirono M, Kamiya R. Tubulin polyglutamylation regulates axonemal motility by modulating activities of inner-arm dyneins. Curr Biol. 2010 Mar 9;20(5):441-5. doi: 10.1016/j.cub.2009.12.058. Epub 2010 Feb 25. PMID: 20188560.
Sakato-Antoku M, King SM. Outer-arm dynein light chain LC1 is required for normal motor assembly kinetics, ciliary stability, and motility. Mol Biol Cell. 2023 Jun 1;34(7):ar75. doi: 10.1091/mbc.E23-03-0104. Epub 2023 May 3. PMID: 37133971; PMCID: PMC10295483.
- «Previous Page
- 1
- …
- 122
- 123
- 124
- 125
- 126
- …
- 133
- Next Page»