From Tyler Picariello, George Witman lab, University of Massachusetts Medical School, February 2019


Picariello T, Brown JM, Hou Y, Swank G, Cochran DA, King OD, Lechtreck K, Pazour GJ, Witman GB (2019) A global analysis of IFT-A function reveals specialization for transport of membrane-associated proteins into cilia. J Cell Sci. Feb 11;132(3)


  • Locus:
  • IFT140
  • Chromosome:
  • 8

From Tyler Picariello, George Witman lab, University of Massachusetts Medical School, February 2019


Picariello T, Brown JM, Hou Y, Swank G, Cochran DA, King OD, Lechtreck K, Pazour GJ, Witman GB (2019) A global analysis of IFT-A function reveals specialization for transport of membrane-associated proteins into cilia. J Cell Sci. Feb 11;132(3)


  • Locus:
  • IFT140
  • Chromosome:
  • 8

From Tyler Picariello, George Witman lab, University of Massachusetts Medical School, February 2019


Picariello T, Brown JM, Hou Y, Swank G, Cochran DA, King OD, Lechtreck K, Pazour GJ, Witman GB (2019) A global analysis of IFT-A function reveals specialization for transport of membrane-associated proteins into cilia. J Cell Sci. Feb 11;132(3)


  • Locus:
  • IFT140
  • Chromosome:
  • 8

From Jae-Hyeok Lee, University of British Columbia, March 2019


Kariyawasam T, Hoo S, Goodenough U, Lee JH (2019) Novel approaches for generating and manipulating diploid strains of Chlamydomonas reinhardtii. Algae. 34:35-43

From Jae-Hyeok Lee, University of British Columbia, March 2019


Kariyawasam T, Hoo S, Goodenough U, Lee JH (2019) Novel approaches for generating and manipulating diploid strains of Chlamydomonas reinhardtii. Algae. 34:35-43

From Jae-Hyeok Lee, University of British Columbia, March 2019


Kariyawasam T, Hoo S, Goodenough U, Lee JH (2019) Novel approaches for generating and manipulating diploid strains of Chlamydomonas reinhardtii. Algae. 34:35-43

From Jae-Hyeok Lee, University of British Columbia, March 2019


Kariyawasam T, Hoo S, Goodenough U, Lee JH (2019) Novel approaches for generating and manipulating diploid strains of Chlamydomonas reinhardtii. Algae. 34:35-43

From Heide Evers, Peter Hegemann lab, Humboldt University-Berlin, March 2019

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, March 2019
This is a ChR1 /ChR2 disruption strain, generated with CRISPR/Cas9. 
Background strain               CC-125
Nuclease                               (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                   pAPHVIII (p114), pAPHVII (p360)
Target gene                           ChR1 (COP3), Cre14.g611300
ChR2 (COP4), Cre02.g085257
Target sequence                  ChR1: TGTGGCTTCGTTACGCGGAGTGG (Exon5)
ChR2: GCTCGCGCCCAACGGCACTCAGG (Exon1)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact us if you want to use it.


  • Locus:
  • ChR1, ChR2
  • Chromosome:
  • 14, 2

From Mary Porter, University of Minnesota, March 2019

The original T8D9 background strain contains an insertion in the D1bLIC gene on chromosome 9 that results in defective retrograde IFT and short flagella. In this strain, the d1blic mutation was rescued with a codon optimized-Cherry tagged D1bLIC gene that restores wild-type flagellar length and retrograde IFT.

Background: CC-4487 d1blic [T8D9]
Origin: d1blic mt- was co-transformed with D1bLIC-crCherry and pSI103, selected on paromomycin, and screened for recovery of full-length flagella
Culture maintenance: Well-flagellated cells require culture in dilute media with rocking or aeration for either 2-4 hours in M-N/5 or overnight in TAP
Comment: Rescued cells are paralyzed with some wiggling due to a second, uncharacterized mutation in the original T8D9 strain, but the tagged D1bLIC gene rescues the short flagellar phenotype associated with the d1blic mutation


Perrone CA, Tritschler D, Taulman P, Bower R, Yoder BK, Porter ME (2003) A novel dynein light intermediate chain colocalizes with the retrograde motor for intraflagellar transport at sites of axoneme assembly in chlamydomonas and Mammalian cells. Mol Biol Cell. 14:2041-56
Reck J, Schauer AM, VanderWaal Mills K, Bower R, Tritschler D, Perrone CA, Porter ME (2016) The role of the dynein light intermediate chain in retrograde IFT and flagellar function in Chlamydomonas. Mol Biol Cell. 27:2404-22
Chien A, Shih SM, Bower R, Tritschler D, Porter ME, Yildiz A (2017) Dynamics of the IFT machinery at the ciliary tip. Elife. Sep 20;6

From Mary Porter, University of Minnesota, March 2019

Background: CC-4054, d1blic, mt- (YH43)
Origin: The d1blic (YH43) was co-transformed with pSI103 and a wild-type D1bLIC transgene containing a GFP tag at its carboxy-terminus, selected on paromomycin, and screened for recovery of full-length flagella and expression of D1bLIC-GFP.
Culture maintenance: no special treatment
Comment: The D1bLIC-GFP gene restores full-length flagella and retrograde IFT.


Hou Y, Pazour GJ, Witman GB (2004) A dynein light intermediate chain, D1bLIC, is required for retrograde intraflagellar transport. Mol Biol Cell. 15:4382-94
Reck J, Schauer AM, VanderWaal Mills K, Bower R, Tritschler D, Perrone CA, Porter ME (2016) The role of the dynein light intermediate chain in retrograde IFT and flagellar function in Chlamydomonas. Mol Biol Cell. 27:2404-22

From Mary Porter, University of Minnesota, March 2019

The original T8D9 background strain contains an insertion in the D1bLIC gene on chromosome 9 that results in defective retrograde IFT and short flagella. This strain contains two transgenes, D1bLIC-crCherry and KAP-GFP.

Background: CC-4487 d1blic [T8D9]
Origin: The D1bLIC-crCherry strain was co-transformed with pHyg3 and KAP-GFP, selected on hygromycin, and screened for the presence of KAP-GFP by fluorescence microscopy
Culture maintenance: Well-flagellated cells require culture in dilute media with rocking or aeration for either 2-4 hours in M-N/5 or overnight in TAP
Comment: The host D1bLIC rescued cells are paralyzed with some wiggling due to the second, uncharacterized mutation in the original T8D9 strain. The KAP-GFP transgene is expressed at the same level as the endogenous wild-type KAP protein.


Mueller J, Perrone CA, Bower R, Cole DG, Porter ME (2005) The FLA3 KAP subunit is required for localization of kinesin-2 to the site of flagellar assembly and processive anterograde intraflagellar transport. Mol Biol Cell. 16:1341-54
Chien A, Shih SM, Bower R, Tritschler D, Porter ME, Yildiz A (2017) Dynamics of the IFT machinery at the ciliary tip. Elife. Sep 20;6

From Mary Porter, University of Minnesota, March 2019

CC-4284 bop5-2 (6F5) mt+ was crossed to CC-4264 apml-19 nit1 mt- [Tam L8] to recover bop5-2 in a mt- background. The original bop5-2 strain contains an insertion of the NIT1 gene in the BOP5 locus on chromosome 12. This strain is difficult to flagellate – resuspend in minimal medium or use aeration.
The insertion of the NIT1 gene is associated with a large deletion that removes most of the BOP5 locus and extends into neighboring genes.  There is also another uncharacterized mutation that results in a move backwards only (mbo) phenotype.


Bower R, VanderWaal K, O'Toole E, Fox L, Perrone C, Mueller J, Wirschell M, Kamiya R, Sale WS, Porter ME (2009) IC138 defines a subdomain at the base of the I1 dynein that regulates microtubule sliding and flagellar motility. Mol Biol Cell. 20:3055-63
VanderWaal KE, Yamamoto R, Wakabayashi K, Fox L, Kamiya R, Dutcher SK, Bayly PV, Sale WS, Porter ME (2011) bop5 Mutations reveal new roles for the IC138 phosphoprotein in the regulation of flagellar motility and asymmetric waveforms. Mol Biol Cell. 22:2862-74
Heuser T, Barber CF, Lin J, Krell J, Rebesco M, Porter ME, Nicastro D (2012) Cryoelectron tomography reveals doublet-specific structures and unique interactions in the I1 dynein. Proc Natl Acad Sci U S A. 109:E2067-76


  • Locus:
  • BOP5 [IC138]
  • Chromosome:
  • 12

From Nathan McNeill, George Witman lab, University of Massachusetts Medical School, April 2019

Permissive temperature: 18C – flagella are variable but have average length of one half of wild type
Non-permissive temperature: 32C – flagella shorten rapidly, average less than half of original length


Lechtreck KF, Luro S, Awata J, Witman GB (2009) HA-tagging of putative flagellar proteins in Chlamydomonas reinhardtii identifies a novel protein of intraflagellar transport complex B. Cell Motil Cytoskeleton. 66:469-82

Lechtreck KF, Gould TJ, Witman GB (2013) Flagellar central pair assembly in Chlamydomonas reinhardtii. Cilia. Nov 27;2(1):15

From Steven King, University of Connecticut Health Center, June 2019

The original wdr92-1 mutation came from the CLiP library strain LMJ.RY0402.137495 and was crossed to tpg1-2 by Dr Susan Dutcher.

The strain grows in all standard media (M, R and TAP) and contains a paromomycin resistance cassette in the wdr92 gene. It has a cell wall and makes >7 um long flaccid/floppy flagella that lack all dynein arms.


Patel-King RS, Sakato-Antoku M, Yankova M, King SM. WDR92 Is Required for Axonemal Dynein Heavy Chain Stability in Cytoplasm. Mol Biol Cell. 2019 May 22:mbcE19030139. doi: 10.1091/mbc.E19-03-0139. [Epub ahead of print] PubMed PMID: 31116681.


  • Locus:
  • WRD92, TPG1
  • Chromosome:
  • 16, 17

From Lei Zhao and George Witman, University of Massachusetts Medical School, August 2019

This strain was generated by a cross of LMJ.RY0402.172093 to wild-type strain g1 (CC-5415).


Zhao L, Hou YQ, Picariello T, Craige B, Witman GB (2019) Proteome of the central apparatus of a ciliary axoneme. J Cell Biol. 218: 2051-2070


  • Locus:
  • FAP47
  • Chromosome:
  • 17

From Lei Zhao and George Witman, University of Massachusetts Medical School, August 2019

This strain was generated by transformation of fap47-1 with the plasmid pBC6 containing wild-type FAP47 genomic sequence with a 3xHA tag; this plasmid also contains a hygromycin-resistance cassette (Berthold et al., 2002, Protist).


Zhao L, Hou YQ, Picariello T, Craige B, Witman GB (2019) Proteome of the central apparatus of a ciliary axoneme. J Cell Biol. 218: 2051-2070


  • Locus:
  • FAP47
  • Chromosome:
  • 17

From Lei Zhao and George Witman, University of Massachusetts Medical School, August 2019

This strain was generated by a cross of LMJ.RY0402.112485 to wild-type strain g1 (CC-5415).


Zhao L, Hou YQ, Picariello T, Craige B, Witman GB (2019) Proteome of the central apparatus of a ciliary axoneme. J Cell Biol. 218: 2051-2070


  • Locus:
  • FAP47
  • Chromosome:
  • 17

From Lei Zhao and George Witman, University of Massachusetts Medical School, August 2019

This strain was generated by a cross of LMJ.RY0402.089534 to wild-type strain g1 (CC-5415).


Zhao L, Hou YQ, Picariello T, Craige B, Witman GB (2019) Proteome of the central apparatus of a ciliary axoneme. J Cell Biol. 218: 2051-2070


  • Locus:
  • FAP76
  • Chromosome:
  • 9

From Lei Zhao and George Witman, University of Massachusetts Medical School, August 2019

This strain was generated by transformation of fap76-1 with the plasmid pBC9 containing wild-type FAP76 genomic sequence with a 3xHA tag; this plasmid also contains a hygromycin-resistance cassette (Berthold et al., 2002, Protist).


Zhao L, Hou YQ, Picariello T, Craige B, Witman GB (2019) Proteome of the central apparatus of a ciliary axoneme. J Cell Biol. 218: 2051-2070


  • Locus:
  • FAP76
  • Chromosome:
  • 9

From Lei Zhao and George Witman, University of Massachusetts Medical School, August 2019

This strain was generated by a cross of LMJ.RY0402.183993 to wild-type strain g1 (CC-5415).


Zhao L, Hou YQ, Picariello T, Craige B, Witman GB (2019) Proteome of the central apparatus of a ciliary axoneme. J Cell Biol. 218: 2051-2070


  • Locus:
  • FAP99
  • Chromosome:
  • 14

From Lei Zhao and George Witman, University of Massachusetts Medical School, August 2019

This strain was generated by transformation of fap99-1 with the plasmid pBC12 containing wild-type FAP99 genomic sequence with a 3xHA tag; this plasmid also contains a hygromycin-resistance cassette (Berthold et al., 2002, Protist).


Zhao L, Hou YQ, Picariello T, Craige B, Witman GB (2019) Proteome of the central apparatus of a ciliary axoneme. J Cell Biol. 218: 2051-2070


  • Locus:
  • FAP99
  • Chromosome:
  • 14

From Lei Zhao and George Witman, University of Massachusetts Medical School, August 2019

This strain was generated by a cross of LMJ.RY0402.146355 to wild-type strain g1 (CC-5415).


Zhao L, Hou YQ, Picariello T, Craige B, Witman GB (2019) Proteome of the central apparatus of a ciliary axoneme. J Cell Biol. 218: 2051-2070


  • Locus:
  • FAP196
  • Chromosome:
  • 17

From Lei Zhao and George Witman, University of Massachusetts Medical School, August 2019

This strain was generated by transformation of fap196-1 with the plasmid pBC17 containing wild-type FAP196 genomic sequence with a 3xHA tag; this plasmid also contains a hygromycin-resistance cassette (Berthold et al., 2002, Protist).


Zhao L, Hou YQ, Picariello T, Craige B, Witman GB (2019) Proteome of the central apparatus of a ciliary axoneme. J Cell Biol. 218: 2051-2070


  • Locus:
  • FAP196
  • Chromosome:
  • 17

From Lei Zhao and George Witman, University of Massachusetts Medical School, August 2019

This strain was generated by cross of LMJ.RY0402.135524 to wild-type strain g1 (CC-5415).


Zhao L, Hou YQ, Picariello T, Craige B, Witman GB (2019) Proteome of the central apparatus of a ciliary axoneme. J Cell Biol. 218: 2051-2070


  • Locus:
  • FAP246
  • Chromosome:
  • 14

From Lei Zhao and George Witman, University of Massachusetts Medical School, August 2019

This strain was generated by transformation of fap246-1 with the plasmid pBC22 containing wild-type FAP246 genomic sequence with a 3xHA tag; this plasmid also contains a hygromycin-resistance cassette (Berthold et al., 2002, Protist).


Zhao L, Hou YQ, Picariello T, Craige B, Witman GB (2019) Proteome of the central apparatus of a ciliary axoneme. J Cell Biol. 218: 2051-2070


  • Locus:
  • FAP246
  • Chromosome:
  • 14

From Lei Zhao and George Witman, University of Massachusetts Medical School, August 2019

This strain was generated by cross of LMJ.RY0402.074963 to wild-type strain g1 (CC-5415).


Zhao L, Hou YQ, Picariello T, Craige B, Witman GB (2019) Proteome of the central apparatus of a ciliary axoneme. J Cell Biol. 218: 2051-2070


  • Locus:
  • DPY30
  • Chromosome:
  • 6

From Lei Zhao and George Witman, University of Massachusetts Medical School, August 2019

This strain was generated by transformation of dpy30-1 with the plasmid pBC24 containing wild-type DPY30 genomic sequence with a 3xHA tag; this plasmid also contains a hygromycin-resistance cassette (Berthold et al., 2002, Protist).


Zhao L, Hou YQ, Picariello T, Craige B, Witman GB (2019) Proteome of the central apparatus of a ciliary axoneme. J Cell Biol. 218: 2051-2070


  • Locus:
  • DPY30
  • Chromosome:
  • 6