From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by a UV mutagenesis screen to identify aflagellate mutants. This strain is aflagellate.

Notes:
A nonsense mutation in the RPGRIP1L gene at chromosome_14: 3725856 that leads to K629Stop


Lin H, Guo S, Dutcher SK (2018) RPGRIP1L helps to establish the ciliary gate for entry of proteins. J Cell Sci. Oct 26;131(20)

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by a cross between rpg1-1 and NPHP4-HAN. This strain is aflagellate.

Notes:
A nonsense mutation in the RPGRIP1L gene at chromosome_14: 3725856 that leads to K629Stop


Lin H, Guo S, Dutcher SK (2018) RPGRIP1L helps to establish the ciliary gate for entry of proteins. J Cell Sci. Oct 26;131(20)

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

The ift140-3 mutant was generated by UV mutagenesis screen to identify aflagellate mutants. This strain is generated by a cross between ift140-3 and NPHP4-HAN. This strain is aflagellate.

Notes:
A nonsense mutation in the IFT140 gene at chromosome_8: 1134675-76 that leads to K386Stop


Lin H, Guo S, Dutcher SK (2018) RPGRIP1L helps to establish the ciliary gate for entry of proteins. J Cell Sci. Oct 26;131(20)

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by insertional mutagenesis and is aflagellate.

Insertion into exon 18 of FLA10 (Cre17.g730950) at chromosome_17: 4322754-4322816


Lin H, Cliften PF, Dutcher SK (2018) MAPINS, a Highly Efficient Detection Method That Identifies Insertional Mutations and Complex DNA Rearrangements. Plant Physiol. 178(4):1436-1447


  • Locus:
  • FLA10
  • Chromosome:
  • 17

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by insertional mutagenesis and has no obvious phenotype.

Insertion into intron 9 of MYSM1 (Cre03.g176651) at chromosome_3: 4539389-4539406


Lin H, Cliften PF, Dutcher SK (2018) MAPINS, a Highly Efficient Detection Method That Identifies Insertional Mutations and Complex DNA Rearrangements. Plant Physiol. 178(4):1436-1447


  • Locus:
  • MYSM1
  • Chromosome:
  • 3

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by insertional mutagenesis and has no obvious phenotype.

Insertion into 3’ UTR of FAP22 (Cre17.g721250) at chromosome_17: 3105419-3105428


Lin H, Cliften PF, Dutcher SK (2018) MAPINS, a Highly Efficient Detection Method That Identifies Insertional Mutations and Complex DNA Rearrangements. Plant Physiol. 178(4):1436-1447


  • Locus:
  • FAP22
  • Chromosome:
  • 17

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by insertional mutagenesis and is aflagellate and contains complex DNA rearragement.

Insertion/deletion into multiple genes: deletion of 841 bp (exons 5-8) on Cre02.g145950 at chromosome_2: 7226958-7227798; insertion into 3’ UTR of PTK24 at chromosome_2: 7290053; an unknown region starting at chromosome_12: 7660573 that has no predicted gene is likely to insert into chromosome_2.


Lin H, Cliften PF, Dutcher SK (2018) MAPINS, a Highly Efficient Detection Method That Identifies Insertional Mutations and Complex DNA Rearrangements. Plant Physiol. 178(4):1436-1447

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by insertional mutagenesis and has no obvious phenotype. This is the only mutation identified by whole genome sequencing but no cosegregation test has been done.

Insertion into the TPRC3 (Cre01.g029400) gene at chromosome_1: 4336001-4336135


Lin H, Cliften PF, Dutcher SK (2018) MAPINS, a Highly Efficient Detection Method That Identifies Insertional Mutations and Complex DNA Rearrangements. Plant Physiol. 178(4):1436-1447


  • Locus:
  • TPRC3
  • Chromosome:
  • 1

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by insertional mutagenesis and is aflagellate.

Insertion into exon 13 of the BLD11 (Cre16.g672200) gene at chromosome_16:6582926-6582930


Lin H, Cliften PF, Dutcher SK (2018) MAPINS, a Highly Efficient Detection Method That Identifies Insertional Mutations and Complex DNA Rearrangements. Plant Physiol. 178(4):1436-1447

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by insertional mutagenesis and is aflagellate.

Insertion into intron 14 and exon 15 of the BLD11 (Cre16.g672200) gene at chromosome_16: 6583673-6583708


Lin H, Cliften PF, Dutcher SK (2018) MAPINS, a Highly Efficient Detection Method That Identifies Insertional Mutations and Complex DNA Rearrangements. Plant Physiol. 178(4):1436-1447

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by insertional mutagenesis and has no obvious mutant phenotype.

Insertion into 5’ UTR of TMEM45B (Cre06.g283900) at chromosome_6: 5398524-5398526


Lin H, Cliften PF, Dutcher SK (2018) MAPINS, a Highly Efficient Detection Method That Identifies Insertional Mutations and Complex DNA Rearrangements. Plant Physiol. 178(4):1436-1447

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by insertional mutagenesis and has no obvious mutant phenotype.

Insertion into 5’ UTR of Cre02.g086300 at chromosome_2: 1736814


Lin H, Cliften PF, Dutcher SK (2018) MAPINS, a Highly Efficient Detection Method That Identifies Insertional Mutations and Complex DNA Rearrangements. Plant Physiol. 178(4):1436-1447

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by insertional mutagenesis and has no obvious mutant phenotype.

Insertion into exon 4 of Cre06.g278262 at chromosome_6: 4339867-4339917


Lin H, Cliften PF, Dutcher SK (2018) MAPINS, a Highly Efficient Detection Method That Identifies Insertional Mutations and Complex DNA Rearrangements. Plant Physiol. 178(4):1436-1447

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by insertional mutagenesis and has no obvious mutant phenotype but contains complex DNA rearragement.

Insertion into 5’ UTR of Cre06.g278107 at chromosome_6: 3512412, a piece from chromosome_5: 1676418 is also inserted into this region


Lin H, Cliften PF, Dutcher SK (2018) MAPINS, a Highly Efficient Detection Method That Identifies Insertional Mutations and Complex DNA Rearrangements. Plant Physiol. 178(4):1436-1447

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by insertional mutagenesis and has a slow growth defect.

Insertion into intron 16 of MITC17 (Cre16.g650200) at chromosome_16: 1141900


Lin H, Cliften PF, Dutcher SK (2018) MAPINS, a Highly Efficient Detection Method That Identifies Insertional Mutations and Complex DNA Rearrangements. Plant Physiol. 178(4):1436-1447


  • Locus:
  • MITC17
  • Chromosome:
  • 16

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by insertional mutagenesis and has no obvious mutant phenotype.

Insertion into 3’ UTR of ATG11 (Cre16.g651350) at chromosome_16:1266125-1266130


Lin H, Cliften PF, Dutcher SK (2018) MAPINS, a Highly Efficient Detection Method That Identifies Insertional Mutations and Complex DNA Rearrangements. Plant Physiol. 178(4):1436-1447


  • Locus:
  • ATG11
  • Chromosome:
  • 16

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by insertional mutagenesis and has no obvious mutant phenotype.

Insertion into exon 13 of Cre06.g263650 at chromosome_6: 1938823-1938849


Lin H, Cliften PF, Dutcher SK (2018) MAPINS, a Highly Efficient Detection Method That Identifies Insertional Mutations and Complex DNA Rearrangements. Plant Physiol. 178(4):1436-1447

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by insertional mutagenesis and has no obvious mutant phenotype but contains complex DNA rearrangement.

Insertion into intron 11 of PHC10 (Cre09.g404201) at chromosome_9: 497660, with DNA fragments from chromosome_13: 3741836


Lin H, Cliften PF, Dutcher SK (2018) MAPINS, a Highly Efficient Detection Method That Identifies Insertional Mutations and Complex DNA Rearrangements. Plant Physiol. 178(4):1436-1447


  • Locus:
  • PHC10
  • Chromosome:
  • 9

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by insertional mutagenesis and contains multiple flagella.

Insertion into intron 5 of the BAR1 (Cre16.g653450) gene at chromosome_16: 1549854-1549855


Lin H, Cliften PF, Dutcher SK (2018) MAPINS, a Highly Efficient Detection Method That Identifies Insertional Mutations and Complex DNA Rearrangements. Plant Physiol. 178(4):1436-1447


  • Locus:
  • BAR1
  • Chromosome:
  • 16

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by insertional mutagenesis and has no obvious mutant phenotype.

Insertions into 5’ UTR of Cre17.g735550 at chromosome_17: 5178817 and exon 5 of Cre17.g736000 at chromosome_17: 5244723


Lin H, Cliften PF, Dutcher SK (2018) MAPINS, a Highly Efficient Detection Method That Identifies Insertional Mutations and Complex DNA Rearrangements. Plant Physiol. 178(4):1436-1447

From Tyler Picariello, George Witman lab, University of Massachusetts Medical School, February 2019


Picariello T, Brown JM, Hou Y, Swank G, Cochran DA, King OD, Lechtreck K, Pazour GJ, Witman GB (2019) A global analysis of IFT-A function reveals specialization for transport of membrane-associated proteins into cilia. J Cell Sci. Feb 11;132(3)


  • Locus:
  • IFT140
  • Chromosome:
  • 8

From Tyler Picariello, George Witman lab, University of Massachusetts Medical School, February 2019


Picariello T, Brown JM, Hou Y, Swank G, Cochran DA, King OD, Lechtreck K, Pazour GJ, Witman GB (2019) A global analysis of IFT-A function reveals specialization for transport of membrane-associated proteins into cilia. J Cell Sci. Feb 11;132(3)


  • Locus:
  • IFT140
  • Chromosome:
  • 8

From Tyler Picariello, George Witman lab, University of Massachusetts Medical School, February 2019


Picariello T, Brown JM, Hou Y, Swank G, Cochran DA, King OD, Lechtreck K, Pazour GJ, Witman GB (2019) A global analysis of IFT-A function reveals specialization for transport of membrane-associated proteins into cilia. J Cell Sci. Feb 11;132(3)


  • Locus:
  • IFT140
  • Chromosome:
  • 8

From Tyler Picariello, George Witman lab, University of Massachusetts Medical School, February 2019


Picariello T, Brown JM, Hou Y, Swank G, Cochran DA, King OD, Lechtreck K, Pazour GJ, Witman GB (2019) A global analysis of IFT-A function reveals specialization for transport of membrane-associated proteins into cilia. J Cell Sci. Feb 11;132(3)


  • Locus:
  • IFT140
  • Chromosome:
  • 8

From Tyler Picariello, George Witman lab, University of Massachusetts Medical School, February 2019


Picariello T, Brown JM, Hou Y, Swank G, Cochran DA, King OD, Lechtreck K, Pazour GJ, Witman GB (2019) A global analysis of IFT-A function reveals specialization for transport of membrane-associated proteins into cilia. J Cell Sci. Feb 11;132(3)


  • Locus:
  • IFT140
  • Chromosome:
  • 8

From Jae-Hyeok Lee, University of British Columbia, March 2019


Kariyawasam T, Hoo S, Goodenough U, Lee JH (2019) Novel approaches for generating and manipulating diploid strains of Chlamydomonas reinhardtii. Algae. 34:35-43

From Jae-Hyeok Lee, University of British Columbia, March 2019


Kariyawasam T, Hoo S, Goodenough U, Lee JH (2019) Novel approaches for generating and manipulating diploid strains of Chlamydomonas reinhardtii. Algae. 34:35-43

From Jae-Hyeok Lee, University of British Columbia, March 2019


Kariyawasam T, Hoo S, Goodenough U, Lee JH (2019) Novel approaches for generating and manipulating diploid strains of Chlamydomonas reinhardtii. Algae. 34:35-43

From Jae-Hyeok Lee, University of British Columbia, March 2019


Kariyawasam T, Hoo S, Goodenough U, Lee JH (2019) Novel approaches for generating and manipulating diploid strains of Chlamydomonas reinhardtii. Algae. 34:35-43

From Heide Evers, Peter Hegemann lab, Humboldt University-Berlin, March 2019

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, March 2019
This is a ChR1 /ChR2 disruption strain, generated with CRISPR/Cas9. 
Background strain               CC-125
Nuclease                               (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                   pAPHVIII (p114), pAPHVII (p360)
Target gene                           ChR1 (COP3), Cre14.g611300
ChR2 (COP4), Cre02.g085257
Target sequence                  ChR1: TGTGGCTTCGTTACGCGGAGTGG (Exon5)
ChR2: GCTCGCGCCCAACGGCACTCAGG (Exon1)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact us if you want to use it.


  • Locus:
  • ChR1, ChR2
  • Chromosome:
  • 14, 2