Strains

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a VGCC disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
Target gene: VGCC, g11458
Target sequence: GAATGTAGGAGCCCTTCCCGCGG (Exon 4)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a VGCC disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
Target gene: VGCC, g11458
Target sequence: GATCAAACCCCGCAAGTACGAGG (Exon2)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a VGCC disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-3403 (mt-)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pHR11
Target gene: VGCC, g11458

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a VGCC disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-3403 (mt-)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pArg
Target gene: VGCC, g11458

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a COP5 disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-3403 (mt-)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pHR11
Target gene: COP5, Cre02.g074150
Target sequence: GCAGCACCTCCAGACTGACGCGG (Exon 6)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a COP5 disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-3403 (mt-)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pHR11
Target gene: COP5, Cre02.g074150
Target sequence: GGTGTACTCGGTGATGCTGGCGG (Exon 4)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a UVR8 disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-3403 (mt-)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pHR11
Target gene: UVR8, Cre05.g230600
Target sequence: CGAGGACAGATCTACAGCTGGGG (Exon 2)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a UVR8  disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-3403 (mt-)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pHR11
Target gene: UVR8, Cre05.g230600
Target sequence: CGAGGACAGATCTACAGCTGGGG (Exon 2)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a UVR8 disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: UVR8, Cre05.g230600
Target sequence: CGGCGTCACAGTGACGAGTGTGG

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a UVR8 disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: UVR8, Cre05.g230600
Target sequence: CGGCGTCACAGTGACGAGTGTGG (Exon 6)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a COP5 disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
Target gene: COP5, Cre02.g074150
Target sequence: GCAGCACCTCCAGACTGACGCGG (Exon g6)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a PHOT/ UVR8 double disruption strain, generated with CRISPR/Cas9.

Background strain: CC-5440 ∆UVR8-I8-E4 (based on CC-3403)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: PHOT, Cre03.g199000
Target sequence: GACTGGATATGGACCCGATGAGG (Exon 2)

CC-5440 ∆UVR8-I8-E4 mt- [PH050] strain info:
Marker: pArg
Target gene: UVR8, Cre05.g230600
Target sequence: CGAGGACAGATCTACAGCTGGGG (Exon2)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a PHOT/ UVR8 double disruption strain, generated with CRISPR/Cas9.

Background strain: CC-5440 ∆UVR8-I8-E4 (based on CC-3403)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: PHOT, Cre03.g199000
Target sequence: GACTGGATATGGACCCGATGAGG (Exon 2)

CC-5440 ∆UVR8-I8-E4 mt- [PH050] strain info:
Marker: pArg
Target gene: UVR8, Cre05.g230600
Target sequence: CGAGGACAGATCTACAGCTGGGG (Exon2)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a PHOT/ UVR8 double disruption strain, generated with CRISPR/Cas9.

Background strain: CC-5392 ∆PHOT-B5 [PH15] (based on CC-125)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: UVR8, Cre05.g230600
Target sequence: CGGCGTCACAGTGACGAGTGTGG (Exon 6)

CC-5392 ∆PHOT-B5 [PH15] strain info:
Marker: pAphVII (pPH360)
Target gene: PHOT, Cre03.g199000
Target sequence: GCGCATCCTCAACTACACCAAGG (Exon 6)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a PHOT/ UVR8 double disruption strain, generated with CRISPR/Cas9.

Background strain: CC-5392 ∆PHOT-B5 [PH15] (based on CC-125)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH075)
Target gene: UVR8, Cre05.g230600
Target sequence: CGGCGTCACAGTGACGAGTGTGG (Exon 6)

CC-5392 ∆PHOT-B5 [PH15] strain info:
Marker: pAphVII (pPH360)
Target gene: PHOT, Cre03.g199000
Target sequence: GCGCATCCTCAACTACACCAAGG (Exon 6)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a COP5 disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pIS105)
Target gene: COP5, Cre02.g074150
Target sequence: GCAGCACCTCCAGACTGACGCGG (Exon 6)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a 2-LOG disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a 2-LOG disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain is a spontaneous suppressor of the fla9 mutant and restores flagellar assembly and regeneration defects of fla9.

fla9: point mutation in the IFT81 gene, affects a splice site (c.823-2 A>G) at chromosome_17: 3365104
dgr14-1: 33kb Deletion on chromosome_11: 3603615 – 3636297

Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)

• Locus:
• FLA9, DGR14
• Chromosome:
• 17, 11

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain is a suppressor of ift121-2 generated by UV mutagenesis. It restores aflagellate phenotype of ift121-2.

ift121-2: point mutation in the IFT121 gene, affects a splice site (c.2754+1 G>A) at chromosome_11:2411434
fra10-1: Deletion at chromosome_7:3538004 (deletion of C)

Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)

• Locus:
• IFT121, FRA10
• Chromosome:
• 11, 7

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by a cross between fla9 and ift121-2 fra10-1. It restores flagellar assembly and regeneration defects of fla9.

fla9: point mutation in the IFT81 gene, affects a splice site (c.823-2 A>G) at chromosome_17: 3365104
fra10-1: Deletion at chromosome_7:3538004 (deletion of C)

Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)

• Locus:
• FLA9, FRA10
• Chromosome:
• 17, 7

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by a cross between fla9 and ift121-2 fra10-1 and exhibits normal flagellar assembly and regeneration.

fla9: point mutation in the IFT81 gene, affects a splice site (c.823-2 A>G) at chromosome_17: 3365104
ift121-2: point mutation in the IFT121 gene, affects a splice site (c.2754+1 G>A) at chromosome_11:2411434
fra10-1: Deletion at chromosome_7:3538004 (deletion of C)

Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)

• Locus:
• FLA9, IFT121, FRA10
• Chromosome:
• 17, 11, 7

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by a cross between fla9 and ift121-2 fra10::FRA10-TG and has a flagellar assembly defect.

fla9: point mutation in the IFT81 gene, affects a splice site (c.823-2 A>G) at chromosome_17: 3365104
fra10-1: Deletion at chromosome_7:3538004 (deletion of C)
FRA10-TG: Wild-type copy of FRA10 gene obtained by transformation

Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)

• Locus:
• FLA9, FRA10
• Chromosome:
• 17, 7

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by a cross between fla9 dgr14-1 and ift121-2 and exhibits normal flagellar assembly and regeneration.

fla9: point mutation in the IFT81 gene, affects a splice site (c.823-2 A>G) at chromosome_17: 3365104
dgr14-1: 33kb Deletion on chromosome_11: 3603615 – 3636297
ift121-2: point mutation in the IFT121 gene, affects a splice site (c.2754+1 G>A) at chromosome_11:2411434

Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)

• Locus:
• FLA9, DGR14, IFT121,
• Chromosome:
• 17, 11, 11

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated from a cross between fla9 dgr14-1 fra10-1 and CC-124 to remove fla9 and fra10-1 mutation. There is no apparent growth or motility defect.

dgr14-1: 33kb Deletion on chromosome_11: 3603615 – 3636297

Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)

• Locus:
• DGR14
• Chromosome:
• 11

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated from a cross between fla9 dgr14-1 fra10-1 and CC-124 to remove the fla9 and dgr14-1 mutation. There is no apparent growth or motility defect.

fra10-1: Deletion at chromosome_7:3538004 (deletion of C)

Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)

• Locus:
• FRA10
• Chromosome:
• 7

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated from a cross between fla9 dgr14-1::DGR14TG and CC-125 to remove fla9 mutation. There is no apparent growth or motility defect.

dgr14-1: 33kb Deletion on chromosome_11: 3603615 – 3636297
DGR14TG: Wild-type copy of DGR14 gene inserted by transformation

Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)

• Locus:
• DGR14
• Chromosome:
• 11

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated from a cross between ift121 fra10-1::FRA10TG and CC-125 to remove ift121-1 mutation. There is no apparent growth or motility defect.

fra10-1: Deletion at chromosome_7:3538004 (deletion of C)
FRA10TG: Wild-type copy of FRA10 gene inserted by transformation

Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)

• Locus:
• FRA10
• Chromosome:
• 7

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain is from a cross between fla9 dgr14-1 fra10-1 and CC-124 to remove fla9 mutation. There is no apparent growth or motility defect.

dgr14-1: 33 kb deletion on chromosome_11: 3603615 – 3636297
fra10-1: Deletion at chromosome_7:3538004

Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)

• Locus:
• DGR14, FRA10
• Chromosome:
• 11, 7

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated from a cross between kif6 smg1-2 and dgr14-1 to remove kif6 and dgr14-1 mutation. There is no apparent growth or motility defect.

smg1-2: Mis-sense mutation at chromosome_13:1417593 (G > T) that introduce premature stop codon

Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)

• Locus:
• SMG1
• Chromosome:
• 13