From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a UVR8  disruption strain, generated with CRISPR/Cas9.

Background strain            CC-3403 (mt-)
Nuclease                              (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                  pHR11
Target gene                         UVR8, Cre05.g230600
Target sequence                CGAGGACAGATCTACAGCTGGGG (Exon 2)


Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit for more info or contact

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a UVR8 disruption strain, generated with CRISPR/Cas9.

Background strain                 CC-125 mt+
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAPHVIII (pPH75)
Target gene                              UVR8, Cre05.g230600
Target sequence                     CGGCGTCACAGTGACGAGTGTGG


Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit for more info or contact

This is an unpublished strain. Please contact before using it.

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a UVR8 disruption strain, generated with CRISPR/Cas9.

Background strain                 CC-125 mt+
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAPHVIII (pPH75)
Target gene                              UVR8, Cre05.g230600
Target sequence                     CGGCGTCACAGTGACGAGTGTGG (Exon 6)


Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit for more info or contact

This is an unpublished strain. Please contact before using it.

From Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a COP5 disruption strain, generated with CRISPR/Cas9.

Background strain                 CC-125 mt+
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAphVII (pPH360)
Target gene                              COP5, Cre02.g074150
Target sequence                     GCAGCACCTCCAGACTGACGCGG (Exon g6)


Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit for more info or contact

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a PHOT/ UVR8 double disruption strain, generated with CRISPR/Cas9.

Background strain  CC-5440 ∆UVR8-I8-E4 (based on CC-3403)
Nuclease                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                       pAPHVIII (pPH75)
Target gene              PHOT, Cre03.g199000
Target sequence     GACTGGATATGGACCCGATGAGG (Exon 2)


CC-5440 ∆UVR8-I8-E4 mt- [PH050] strain info:
Marker                       pArg
Target gene              UVR8, Cre05.g230600
Target sequence     CGAGGACAGATCTACAGCTGGGG (Exon2)


Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit for more info or contact

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a PHOT/ UVR8 double disruption strain, generated with CRISPR/Cas9.

Background strain  CC-5440 ∆UVR8-I8-E4 (based on CC-3403)
Nuclease                  (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                       pAPHVIII (pPH75)
Target gene              PHOT, Cre03.g199000
Target sequence     GACTGGATATGGACCCGATGAGG (Exon 2)


CC-5440 ∆UVR8-I8-E4 mt- [PH050] strain info:
Marker                       pArg
Target gene              UVR8, Cre05.g230600
Target sequence     CGAGGACAGATCTACAGCTGGGG (Exon2)


Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit for more info or contact

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December

This is a PHOT/ UVR8 double disruption strain, generated with CRISPR/Cas9.

Background strain   CC-5392 ∆PHOT-B5 [PH15] (based on CC-125)
Nuclease                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                       pAPHVIII (pPH75)
Target gene              UVR8, Cre05.g230600
Target sequence     CGGCGTCACAGTGACGAGTGTGG (Exon 6)


CC-5392 ∆PHOT-B5 [PH15] strain info:
Marker                       pAphVII (pPH360)
Target gene              PHOT, Cre03.g199000
Target sequence     GCGCATCCTCAACTACACCAAGG (Exon 6)


Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit for more info or contact

This is an unpublished strain. Please contact before using it.

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a PHOT/ UVR8 double disruption strain, generated with CRISPR/Cas9.

Background strain   CC-5392 ∆PHOT-B5 [PH15] (based on CC-125)
Nuclease                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                       pAPHVIII (pPH075)
Target gene              UVR8, Cre05.g230600
Target sequence     CGGCGTCACAGTGACGAGTGTGG (Exon 6)


CC-5392 ∆PHOT-B5 [PH15] strain info:
Marker                       pAphVII (pPH360)
Target gene              PHOT, Cre03.g199000
Target sequence     GCGCATCCTCAACTACACCAAGG (Exon 6)


Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit for more info or contact

This is an unpublished strain. Please contact before using it.

From Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a COP5 disruption strain, generated with CRISPR/Cas9.

Background strain                 CC-125 mt+
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAPHVIII (pIS105)
Target gene                              COP5, Cre02.g074150
Target sequence                     GCAGCACCTCCAGACTGACGCGG (Exon 6)


Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit for more info or contact

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, January 2019

This is a 2-LOG disruption strain, generated with CRISPR/Cas9.

Background strain                  CC-125 mt+
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAPHVIII (pPH75)


Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit for more info or contact

This is an unpublished strain. Please contact before using it.

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a 2-LOG disruption strain, generated with CRISPR/Cas9.

Background strain                  CC-125 mt+
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAPHVIII (pPH75)


Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit for more info or contact

This is an unpublished strain. Please contact before using it.

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain is a spontaneous suppressor of the fla9 mutant and restores flagellar assembly and regeneration defects of fla9.

fla9: point mutation in the IFT81 gene, affects a splice site (c.823-2 A>G) at chromosome_17: 3365104
dgr14-1: 33kb Deletion on chromosome_11: 3603615 – 3636297

Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)

  • Locus:
  • FLA9, DGR14
  • Chromosome:
  • 17, 11

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain is a suppressor of ift121-2 generated by UV mutagenesis. It restores aflagellate phenotype of ift121-2.

ift121-2: point mutation in the IFT121 gene, affects a splice site (c.2754+1 G>A) at chromosome_11:2411434
fra10-1: Deletion at chromosome_7:3538004 (deletion of C)

Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)

  • Locus:
  • IFT121, FRA10
  • Chromosome:
  • 11, 7

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by a cross between fla9 and ift121-2 fra10-1. It restores flagellar assembly and regeneration defects of fla9.

fla9: point mutation in the IFT81 gene, affects a splice site (c.823-2 A>G) at chromosome_17: 3365104
fra10-1: Deletion at chromosome_7:3538004 (deletion of C)

Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)

  • Locus:
  • FLA9, FRA10
  • Chromosome:
  • 17, 7

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by a cross between fla9 and ift121-2 fra10-1 and exhibits normal flagellar assembly and regeneration.

fla9: point mutation in the IFT81 gene, affects a splice site (c.823-2 A>G) at chromosome_17: 3365104
ift121-2: point mutation in the IFT121 gene, affects a splice site (c.2754+1 G>A) at chromosome_11:2411434
fra10-1: Deletion at chromosome_7:3538004 (deletion of C)

Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)

  • Locus:
  • FLA9, IFT121, FRA10
  • Chromosome:
  • 17, 11, 7

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by a cross between fla9 and ift121-2 fra10::FRA10-TG and has a flagellar assembly defect.

fla9: point mutation in the IFT81 gene, affects a splice site (c.823-2 A>G) at chromosome_17: 3365104
fra10-1: Deletion at chromosome_7:3538004 (deletion of C)
FRA10-TG: Wild-type copy of FRA10 gene obtained by transformation

Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)

  • Locus:
  • FLA9, FRA10
  • Chromosome:
  • 17, 7

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by a cross between fla9 dgr14-1 and ift121-2 and exhibits normal flagellar assembly and regeneration.

fla9: point mutation in the IFT81 gene, affects a splice site (c.823-2 A>G) at chromosome_17: 3365104
dgr14-1: 33kb Deletion on chromosome_11: 3603615 – 3636297
ift121-2: point mutation in the IFT121 gene, affects a splice site (c.2754+1 G>A) at chromosome_11:2411434

Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)

  • Locus:
  • FLA9, DGR14, IFT121,
  • Chromosome:
  • 17, 11, 11

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated from a cross between fla9 dgr14-1 fra10-1 and CC-124 to remove fla9 and fra10-1 mutation. There is no apparent growth or motility defect.

dgr14-1: 33kb Deletion on chromosome_11: 3603615 – 3636297

Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)

  • Locus:
  • DGR14
  • Chromosome:
  • 11

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated from a cross between fla9 dgr14-1 fra10-1 and CC-124 to remove the fla9 and dgr14-1 mutation. There is no apparent growth or motility defect.

fra10-1: Deletion at chromosome_7:3538004 (deletion of C)

Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)

  • Locus:
  • FRA10
  • Chromosome:
  • 7

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated from a cross between fla9 dgr14-1::DGR14TG and CC-125 to remove fla9 mutation. There is no apparent growth or motility defect.

dgr14-1: 33kb Deletion on chromosome_11: 3603615 – 3636297
DGR14TG: Wild-type copy of DGR14 gene inserted by transformation

Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)

  • Locus:
  • DGR14
  • Chromosome:
  • 11

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated from a cross between ift121 fra10-1::FRA10TG and CC-125 to remove ift121-1 mutation. There is no apparent growth or motility defect.

fra10-1: Deletion at chromosome_7:3538004 (deletion of C)
FRA10TG: Wild-type copy of FRA10 gene inserted by transformation

Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)

  • Locus:
  • FRA10
  • Chromosome:
  • 7

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain is from a cross between fla9 dgr14-1 fra10-1 and CC-124 to remove fla9 mutation. There is no apparent growth or motility defect.

dgr14-1: 33 kb deletion on chromosome_11: 3603615 – 3636297
fra10-1: Deletion at chromosome_7:3538004

Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)

  • Locus:
  • DGR14, FRA10
  • Chromosome:
  • 11, 7

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated from a cross between kif6 smg1-2 and dgr14-1 to remove kif6 and dgr14-1 mutation. There is no apparent growth or motility defect.

smg1-2: Mis-sense mutation at chromosome_13:1417593 (G > T) that introduce premature stop codon

Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)

  • Locus:
  • SMG1
  • Chromosome:
  • 13

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated from a cross between kif6 smg1-2 and dgr14-1 to remove the kif6 mutation. There is no apparent growth or motility defect.

smg1-2: Mis-sense mutation at chromosome_13:1417593 (G > T)
dgr14-1: 33 kb deletion on chromosome_11: 3603615 – 3636297

Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)

  • Locus:
  • SMG1, DGR14
  • Chromosome:
  • 13, 11

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated from a cross between kif6 smg1-2 and fra10-1 to remove the kif6 mutation. There is no apparent growth or motility defect.

smg1-2: Mis-sense mutation at chromosome_13:1417593 (G > T)
fra10-1: Deletion at chromosome_7:3538004 (deletion of C)

Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)

  • Locus:
  • SMG1, FRA10
  • Chromosome:
  • 13, 7

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

The origin of this strain is from a spontaneous mutation found in the strain CC-4348, which contains multiple mutations on various genes. The fla11-2 mutant is aflagellate.

An insertion into the exon 2 of IFT172 at chromosome_17: 1081293

Lin H, Guo S, Dutcher SK (2018) RPGRIP1L helps to establish the ciliary gate for entry of proteins. J Cell Sci. Oct 26;131(20)

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

The mutant phenotype of fla11-2 was rescued by introducing the transgene through a cross between fla11-2 and IFT172-FLAG.

Wild-type IFT172 tagged with a 3xFLAG tag at the N-terminus
The tagged plasmid was transformed into wild-type cells

Lin H, Guo S, Dutcher SK (2018) RPGRIP1L helps to establish the ciliary gate for entry of proteins. J Cell Sci. Oct 26;131(20)

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by a cross between fla11-2 IFT172-FLAG and CC-5116 (NPHP4-HAN). This strain has normal flagellar assembly.

Wild-type IFT172 tagged with a 3xFLAG tag at the N-terminus

Lin H, Guo S, Dutcher SK (2018) RPGRIP1L helps to establish the ciliary gate for entry of proteins. J Cell Sci. Oct 26;131(20)

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by a cross between fla11-2 IFT172-FLAG and CC-5116 (NPHP4-HAN). This strain is aflagellate.

Wild-type IFT172 tagged with a 3xFLAG tag at the N-terminus

Lin H, Guo S, Dutcher SK (2018) RPGRIP1L helps to establish the ciliary gate for entry of proteins. J Cell Sci. Oct 26;131(20)

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

Generated by a cross between ift121-2 and NPHP4-HAN. This strain is aflagellate.

ift121-2: point mutation in the IFT121 gene, affects a splice site (c.2754+1 G>A) at chromosome_11:2411434

Lin H, Guo S, Dutcher SK (2018) RPGRIP1L helps to establish the ciliary gate for entry of proteins. J Cell Sci. Oct 26;131(20)

  • Locus:
  • IFT121
  • Chromosome:
  • 11