Strains Archives - Page 108 of 126 - Chlamydomonas Resource Center

* The listed price of $30.00 for cultures and plasmids is for academic and non-profit users. Commercial and industrial users are charged $300.00 for each strain or plasmid and twice the listed price for media components. BACs and fosmids are $50.00 for academic and non-profit users and $500 for commercial/industry. For the Jonikas CLiP mutants, the price is $100.00 each for academic and non-profit users and commercial and industrial users are charged $1000.00. Subscriptions cannot be used for CLiP mutants, BACs nor fosmids.

CC-5403 cpld38 mt-

$30.00

From Tyler Wittkopp, Joseph Noel Lab, The Salk Institute for Biological Studies, March 2018

Heinnickel ML, Alric J, Wittkopp T, Yang W, Catalanotti C, Dent R, Niyogi KK, Wollman FA, Grossman AR (2013) Novel thylakoid membrane GreenCut protein CPLD38 impacts accumulation of the cytochrome b6f complex and associated regulatory processes. J Biol Chem 288:7024-36

Wittkopp TM, Saroussi S, Yang W, Johnson X, Kim RG, Heinnickel ML, Russell JJ, Phuthong W, Dent RM, Broeckling CD, Peers G, Lohr M, Wollman FA, Niyogi KK, Grossman AR (2018) GreenCut protein CPLD49 of Chlamydomonas reinhardtii associates with thylakoid membranes and is required for cytochrome b(6) f complex accumulation. Plant J. 94:1023-1037

Locus:
CPLD38
Chromosome:
1

CC-5404 cpld38 cpld49 mt-

$30.00

From Tyler Wittkopp, Joseph Noel Lab, The Salk Institute for Biological Studies, March 2018

Locus:
CPLD38, CPLD49
Chromosome:
1, 16

CC-5405 hmox1::C1 (cDNA) complemented mt+

$30.00

From Tyler Wittkopp, Joseph Noel Lab, The Salk Institute for Biological Studies, March 2018

Wittkopp TM, Schmollinger S, Saroussi S, Hu W, Zhang W, Fan Q, Gallaher SD, Leonard MT, Soubeyrand E, Basset GJ, Merchant SS, Grossman AR, Duanmu D, Lagarias JC (2017) Bilin-Dependent Photoacclimation in Chlamydomonas reinhardtii. Plant Cell 29:2711-2726

Locus:
HMOX1
Chromosome:
10

CC-5406 dyf13 mt+

$30.00

From Hiroaki Ishikawa, Wallace Marshall Lab, UCSF, March 2018

The dyf13 mutant was obtained by UV-mutagenesis and screening for slow-swimming cells in the Kamiya lab at the University of Tokyo. DYF13 encodes an IFT complex B protein, IFT56/DYF13.

Ishikawa H, Ide T, Yagi T, Jiang X, Hirono M, Sasaki H, Yanagisawa H, Wemmer KA, Stainier DY, Qin H, Kamiya R, Marshall WF (2014) TTC26/DYF13 is an intraflagellar transport protein required for transport of motility-related proteins into flagella. Elife 3:e01566

Locus:
DYF13
Chromosome:

CC-5407 dyf13 mt-

$30.00

From Hiroaki Ishikawa, Wallace Marshall Lab, UCSF, March 2018

The dyf13 mutant was obtained by UV-mutagenesis and screening for slow-swimming cells in the Kamiya lab at the University of Tokyo. DYF13 encodes an IFT complex B protein, IFT56/DYF13.

Locus:
DYF13
Chromosome:

CC-5408 pf18 fla3 KAP-GFP

$30.00

From Hiroaki Ishikawa, Wallace Marshall Lab, UCSF, March 2018

This mutant was created by crossing pf18 (CC-1036) to fla3 KAP-GFP (CC-4296). This strain has the mutant pf18 and fla3 alleles.

Mueller J, Perrone CA, Bower R, Cole DG, Porter ME (2005) The FLA3 KAP subunit is required for localization of kinesin-2 to the site of flagellar assembly and processive anterograde intraflagellar transport. Mol Biol Cell 16:1341–1354

Engel BD, Lechtreck KF, Sakai T, Ikebe M, Witman GB, Marshall WF (2009) Total Internal Reflection Fluorescence (TIRF) Microscopy of Chlamydomonas Flagella. Methods Cell Biol 93:157-177

Engel BD, Ludington WB, Marshall WF (2009) Intraflagellar transport particle size scales inversely with flagellar length: revisiting the balance-point length control model. J Cell Biol 187:81–89

Locus:
PF18, FLA3
Chromosome:
02, 10

CC-5409 pf18 IFT27-GFP

$30.00

From Hiroaki Ishikawa, Wallace Marshall Lab, UCSF, March 2018

This mutant was created by crossing pf18 with IFT27-GFP. IFT27-GFP is weakly expressed.

Qin H, Diener DR, Geimer S, Cole DG, Rosenbaum JL (2004) Intraflagellar transport (IFT) cargo: IFT transports flagellar precursors to the tip and turnover products to the cell body. J Cell Biol 164:255–266

Engel BD, Lechtreck KF, Sakai T, Ikebe M, Witman GB, Marshall WF (2009) Total Internal Reflection Fluorescence (TIRF) Microscopy of Chlamydomonas Flagella. Methods Cell Biol 93:157-177

Engel BD, Ludington WB, Marshall WF (2009) Intraflagellar transport particle size scales inversely with flagellar length: revisiting the balance-point length control model. J Cell Biol 187:81–89

Locus:
PF18
Chromosome:
02

CC-5410 chli1/fdx3 mt+ [CAL029C_08]

$30.00

From Dr. Bernard Grimm, Humboldt University-Berlin & Dr. Krishna Niyogi, University of California-Berkeley, March 2018

Culture Maintenance: TAP, dark, replate 4-6 weeks.

Brzezowski P, Sharifi MN, Dent RM, Morhard MK, Niyogi KK, Grimm B (2016) Mg chelatase in chlorophyll synthesis and retrograde signaling in Chlamydomonas reinhardtii: CHLI2 cannot substitute for CHLI1. J Exp Bot. 67:3925-38

Dent RM, Sharifi MN, Malnoë A, Haglund C, Calderon RH, Wakao S, Niyogi KK (2015) Large-scale insertional mutagenesis of Chlamydomonas supports phylogenomic functional prediction of photosynthetic genes and analysis of classical acetate-requiring mutants. Plant J. 82:337-351

Locus:
CHLI1
Chromosome:
06

CC-5411 ida3::IDA3-HA mt+ [13-13-12]

$30.00

From Emily Hunter, Sale laboratory, Emory University, March 2018

This strain is transformant # 13-13-12. This cell-type has an ida3+ background and has been transformed with an IDA3-HA vector. The HA-tag is embedded within the second exon of IDA3. This cell-type is Hygromycin resistant.

Hunter EL, Lechtreck K, Fu G, Hwang J, Lin H, Gokhale A, Alford LM, Lewis B, Yamamoto R, Kamiya R, Yang F, Nicastro D, Dutcher SK, Wirschell M, Sale WS (2018) The IDA3 adapter, required for IFT transport of I1 dynein, is regulated by ciliary length. Mol Biol Cell. Feb 21. [Epub ahead of print] PubMed PMID: 29467251

Locus:
IDA3
Chromosome:
03

CC-5412 ida3::IDA3-NG mt+ [15-3-14]

$30.00

From Emily Hunter, Sale laboratory, Emory University, March 2018

This strain is transformant # 15-3-14. This cell-type has an ida3+ background and has been transformed with an IDA3-mNeonGreen vector. The NG-tag is embedded within the second exon of IDA3. This cell-type is hygromycin resistant.

Note: 15-3-14 was used for imaging in Hunter et al., 2018.

Locus:
IDA3
Chromosome:
03

CC-5413 ida7 ida3::IDA3-NG mt+ [1-1P]

$30.00

From Emily Hunter, Sale laboratory, Emory University, March 2018

This cell-type contains the ida7 mutation, the ida3 mutation, and a wild-type copy of IDA3-NG. This cell line is Hygromycin resistant. This cell-line was obtained by mating ida7 x ida3; IDA3-NG followed by tetrad analysis. Susan Dutcher assisted in the mating and isolation of this cell-type. This cell-type prefers L-media.

Locus:
IDA3, IDA7
Chromosome:
03, 16

CC-5414 crmex1-2 mt+

$30.00

From Sunghoon Jang, Youngsook Lee Lab, POSTECH-South Korea, April 2018

This strain has a CC-503 cw92 mt+ background and has been transformed with an AphVII cassette. The cassette is embedded within the fourth exon of MEX1. This strain is Hygromycin resistant.

Sunghoon J, Yamaoka Y, Ko Dh, Kurita T, Kim K, Song WY, Hwang JU, Kang BH, Nishida I, Lee Y (2015) Characterization of a Chlamydomonas reinhardtii mutant defective in a maltose transporter. Journal of plant biology. 58:344-351

Locus:
MEX1
Chromosome:
12

CC-5415 nit1 agg1 mt+ [Witman g1]

$30.00

From George Witman, UMASS Medical School, August 2018

This strain, which shows strong negative phototaxis and whose nucleus is easily transformed, is the parent strain for many of the insertional mutants generated in the Witman lab. It is a cross of nit1-305 (from J. Rosenbaum) to CC-124.

Pazour GJ, Sineshchekov OA, Witman GB (1995) Mutational analysis of the phototransduction pathway of Chlamydomonas reinhardtii. J Cell Biol. 131:427-40

Locus:
NIT1, AGG1
Chromosome:
09, 13

CC-5416 met1(UVM)-47A mt-

$30.00

From Takeshi Ohama, Kochi University of Technology-Japan, September 2018

This strain is good for overexpression of various transgenes. This is probably due to the relieved transcriptional repression.

It was created by transforming CC-4533 with plasmid pMJ013b and paromomycin resistance was used for the selection of transformants (Zhang et al., 2014), resulting in met-1.

The ble-GFP construct was then introduced to met-1 and UV-mutagenesis was carried out to obtain met1(UVM)-47A. This strain is resistant to paromomycin and Zeocin.

Kurniasih SD, Yamasaki T, Kong F, Okada S, Widyaningrum D, Ohama T (2016) UV-mediated Chlamydomonas mutants with enhanced nuclear transgene expression by disruption of DNA methylation-dependent and independent silencing systems. Plant Mol Biol. 92:629-641

CC-5417 met1(UVM)-47B mt-

$30.00

From Takeshi Ohama, Kochi University of Technology-Japan, September 2018

This strain is good for overexpression of various transgenes. This is probably due to the relieved transcriptional repression.

CC-5418 met1(UVM)-57 mt-

$30.00

From Takeshi Ohama, Kochi University of Technology-Japan, September 2018

This strain is good for overexpression of various transgenes. This is probably due to the relieved transcriptional repression.

CC-5419 drc11; DRC11-SNAP (C) mt- [#8]

$30.00

From Mary Porter, University of Minnesota, November 2018

The drc11 CLiP mutant LMJ.RY0402.068819 was co-transformed with pHyg and a wild-type, cDNA clone of DRC11 containing a SNAP tag at its carboxy-terminus, selected on hygromycin, and screened for the presence of the SNAP tag by Western blot. The drc11 (fap82) mutation on chromosome 7 rescued in this strain.

Gui L, Song K, Tritschler D, Bower R, Yan S, Dai A, Augspurger K, Sakizadeh J, Grzemska M, Ni T, Porter ME, Nicastro D. Scaffold subunits support associated subunit assembly in the Chlamydomonas ciliary nexin-dynein regulatory complex. Proc Natl Acad Sci U S A. 2019 Nov 12;116(46):23152-23162. doi: 10.1073/pnas.1910960116. Epub 2019 Oct 28. PMID: 31659045; PMCID: PMC6859327.

CC-5420 saga1 mt- [cMJ195]

$30.00

From Alan Itakura, Jonikas lab, Princeton University, January 2019

Cre11.g467712 insertion at Intron 26

Itakura AK, Chan KX, Atkinson N, Pallesen L, Wang L, Reeves G, Patena W, Caspari O, Roth R, Goodenough U, McCormick AJ, Griffiths H, Jonikas MC. A Rubisco-binding protein is required for normal pyrenoid number and starch sheath morphology in Chlamydomonas reinhardtii. Proc Natl Acad Sci U S A. 2019 Sep 10;116(37):18445-18454. doi: 10.1073/pnas.1904587116. Epub 2019 Aug 27. PMID: 31455733; PMCID: PMC6744930.

CC-5421 saga1-2 mt-

$30.00

From Alan Itakura, Jonikas lab, Princeton University, January 2019

Cre11.g467712 insertion at Intron 28

CC-5422 saga1::SAGA1-Venus3xFLAG

$30.00

From Alan Itakura, Jonikas lab, Princeton University, January 2019

Cre11.g467712 insertion at Intron 26; saga1 expressing pRAM118-SAGA1-Venus-3xFLAG

SAGA1 was cloned into the pRAM118 vectors and transformed into strain saga1 (CC-5420). Lines were then selected for antibiotic resistance positive fluorescence. Further details are available in the below publication.

To minimize silencing it is recommended to propagate on paromycin and hygromycin.

CC-5423 saga1::Rbcs1-mCherry

$30.00

From Alan Itakura, Jonikas lab, Princeton University, January 2019

Cre11.g467712 insertion at Intron 26; saga1 mutant transformed with pLM006-Rbcs1-mCherry3xhis

CC-5424 ∆PSR1-D10 mt+ [PH011]

$30.00

Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a PSR1 disruption strain, generated with CRISPR/Cas9.

Background strain: CC-3403 (mt-)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pHR11
Target gene: PSR1, Cre12.g495100
Target sequence: ACTAGCACCGAGCGTTGGCACGG (Exon1)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de