From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a UVR8 disruption strain, generated with CRISPR/Cas9.

Background strain            CC-3403 (mt-)
Nuclease                              (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                  pHR11
Target gene                         UVR8, Cre05.g230600
Target sequence                CGAGGACAGATCTACAGCTGGGG (Exon 2)

  

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a UVR8  disruption strain, generated with CRISPR/Cas9.

Background strain            CC-3403 (mt-)
Nuclease                              (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                  pHR11
Target gene                         UVR8, Cre05.g230600
Target sequence                CGAGGACAGATCTACAGCTGGGG (Exon 2)

  

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a UVR8 disruption strain, generated with CRISPR/Cas9.

Background strain                 CC-125 mt+
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAPHVIII (pPH75)
Target gene                              UVR8, Cre05.g230600
Target sequence                     CGGCGTCACAGTGACGAGTGTGG

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a UVR8 disruption strain, generated with CRISPR/Cas9.

Background strain                 CC-125 mt+
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAPHVIII (pPH75)
Target gene                              UVR8, Cre05.g230600
Target sequence                     CGGCGTCACAGTGACGAGTGTGG (Exon 6)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

From Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a COP5 disruption strain, generated with CRISPR/Cas9.

Background strain                 CC-125 mt+
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAphVII (pPH360)
Target gene                              COP5, Cre02.g074150
Target sequence                     GCAGCACCTCCAGACTGACGCGG (Exon g6)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a PHOT/ UVR8 double disruption strain, generated with CRISPR/Cas9.

Background strain  CC-5440 ∆UVR8-I8-E4 (based on CC-3403)
Nuclease                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                       pAPHVIII (pPH75)
Target gene              PHOT, Cre03.g199000
Target sequence     GACTGGATATGGACCCGATGAGG (Exon 2)

 

CC-5440 ∆UVR8-I8-E4 mt- [PH050] strain info:
Marker                       pArg
Target gene              UVR8, Cre05.g230600
Target sequence     CGAGGACAGATCTACAGCTGGGG (Exon2)

  

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a PHOT/ UVR8 double disruption strain, generated with CRISPR/Cas9.

Background strain  CC-5440 ∆UVR8-I8-E4 (based on CC-3403)
Nuclease                  (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                       pAPHVIII (pPH75)
Target gene              PHOT, Cre03.g199000
Target sequence     GACTGGATATGGACCCGATGAGG (Exon 2)

 

CC-5440 ∆UVR8-I8-E4 mt- [PH050] strain info:
Marker                       pArg
Target gene              UVR8, Cre05.g230600
Target sequence     CGAGGACAGATCTACAGCTGGGG (Exon2)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December

This is a PHOT/ UVR8 double disruption strain, generated with CRISPR/Cas9.

Background strain   CC-5392 ∆PHOT-B5 [PH15] (based on CC-125)
Nuclease                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                       pAPHVIII (pPH75)
Target gene              UVR8, Cre05.g230600
Target sequence     CGGCGTCACAGTGACGAGTGTGG (Exon 6)

 

CC-5392 ∆PHOT-B5 [PH15] strain info:
Marker                       pAphVII (pPH360)
Target gene              PHOT, Cre03.g199000
Target sequence     GCGCATCCTCAACTACACCAAGG (Exon 6)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a PHOT/ UVR8 double disruption strain, generated with CRISPR/Cas9.

Background strain   CC-5392 ∆PHOT-B5 [PH15] (based on CC-125)
Nuclease                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                       pAPHVIII (pPH075)
Target gene              UVR8, Cre05.g230600
Target sequence     CGGCGTCACAGTGACGAGTGTGG (Exon 6)

 

CC-5392 ∆PHOT-B5 [PH15] strain info:
Marker                       pAphVII (pPH360)
Target gene              PHOT, Cre03.g199000
Target sequence     GCGCATCCTCAACTACACCAAGG (Exon 6)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

From Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a COP5 disruption strain, generated with CRISPR/Cas9.

Background strain                 CC-125 mt+
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAPHVIII (pIS105)
Target gene                              COP5, Cre02.g074150
Target sequence                     GCAGCACCTCCAGACTGACGCGG (Exon 6)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, January 2019

This is a 2-LOG disruption strain, generated with CRISPR/Cas9.

Background strain                  CC-125 mt+
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAPHVIII (pPH75)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a 2-LOG disruption strain, generated with CRISPR/Cas9.

Background strain                  CC-125 mt+
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAPHVIII (pPH75)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain is a spontaneous suppressor of the fla9 mutant and restores flagellar assembly and regeneration defects of fla9.

fla9: point mutation in the IFT81 gene, affects a splice site (c.823-2 A>G) at chromosome_17: 3365104
dgr14-1: 33kb Deletion on chromosome_11: 3603615 – 3636297


Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)


  • Locus:
  • FLA9, DGR14
  • Chromosome:
  • 17, 11

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain is a suppressor of ift121-2 generated by UV mutagenesis. It restores aflagellate phenotype of ift121-2.

ift121-2: point mutation in the IFT121 gene, affects a splice site (c.2754+1 G>A) at chromosome_11:2411434
fra10-1: Deletion at chromosome_7:3538004 (deletion of C)


Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)


  • Locus:
  • IFT121, FRA10
  • Chromosome:
  • 11, 7

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by a cross between fla9 and ift121-2 fra10-1. It restores flagellar assembly and regeneration defects of fla9.

fla9: point mutation in the IFT81 gene, affects a splice site (c.823-2 A>G) at chromosome_17: 3365104
fra10-1: Deletion at chromosome_7:3538004 (deletion of C)


Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)


  • Locus:
  • FLA9, FRA10
  • Chromosome:
  • 17, 7

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by a cross between fla9 and ift121-2 fra10-1 and exhibits normal flagellar assembly and regeneration.

fla9: point mutation in the IFT81 gene, affects a splice site (c.823-2 A>G) at chromosome_17: 3365104
ift121-2: point mutation in the IFT121 gene, affects a splice site (c.2754+1 G>A) at chromosome_11:2411434
fra10-1: Deletion at chromosome_7:3538004 (deletion of C)


Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)


  • Locus:
  • FLA9, IFT121, FRA10
  • Chromosome:
  • 17, 11, 7

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by a cross between fla9 and ift121-2 fra10::FRA10-TG and has a flagellar assembly defect.

fla9: point mutation in the IFT81 gene, affects a splice site (c.823-2 A>G) at chromosome_17: 3365104
fra10-1: Deletion at chromosome_7:3538004 (deletion of C)
FRA10-TG: Wild-type copy of FRA10 gene obtained by transformation


Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)


  • Locus:
  • FLA9, FRA10
  • Chromosome:
  • 17, 7

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by a cross between fla9 dgr14-1 and ift121-2 and exhibits normal flagellar assembly and regeneration.

fla9: point mutation in the IFT81 gene, affects a splice site (c.823-2 A>G) at chromosome_17: 3365104
dgr14-1: 33kb Deletion on chromosome_11: 3603615 – 3636297
ift121-2: point mutation in the IFT121 gene, affects a splice site (c.2754+1 G>A) at chromosome_11:2411434


Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)


  • Locus:
  • FLA9, DGR14, IFT121,
  • Chromosome:
  • 17, 11, 11

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated from a cross between fla9 dgr14-1 fra10-1 and CC-124 to remove fla9 and fra10-1 mutation. There is no apparent growth or motility defect.

dgr14-1: 33kb Deletion on chromosome_11: 3603615 – 3636297


Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)


  • Locus:
  • DGR14
  • Chromosome:
  • 11

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated from a cross between fla9 dgr14-1 fra10-1 and CC-124 to remove the fla9 and dgr14-1 mutation. There is no apparent growth or motility defect.

fra10-1: Deletion at chromosome_7:3538004 (deletion of C)


Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)


  • Locus:
  • FRA10
  • Chromosome:
  • 7

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated from a cross between fla9 dgr14-1::DGR14TG and CC-125 to remove fla9 mutation. There is no apparent growth or motility defect.

dgr14-1: 33kb Deletion on chromosome_11: 3603615 – 3636297
DGR14TG: Wild-type copy of DGR14 gene inserted by transformation


Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)


  • Locus:
  • DGR14
  • Chromosome:
  • 11

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated from a cross between ift121 fra10-1::FRA10TG and CC-125 to remove ift121-1 mutation. There is no apparent growth or motility defect.

fra10-1: Deletion at chromosome_7:3538004 (deletion of C)
FRA10TG: Wild-type copy of FRA10 gene inserted by transformation


Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)


  • Locus:
  • FRA10
  • Chromosome:
  • 7

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain is from a cross between fla9 dgr14-1 fra10-1 and CC-124 to remove fla9 mutation. There is no apparent growth or motility defect.

dgr14-1: 33 kb deletion on chromosome_11: 3603615 – 3636297
fra10-1: Deletion at chromosome_7:3538004


Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)


  • Locus:
  • DGR14, FRA10
  • Chromosome:
  • 11, 7

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated from a cross between kif6 smg1-2 and dgr14-1 to remove kif6 and dgr14-1 mutation. There is no apparent growth or motility defect.

smg1-2: Mis-sense mutation at chromosome_13:1417593 (G > T) that introduce premature stop codon


Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)


  • Locus:
  • SMG1
  • Chromosome:
  • 13

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated from a cross between kif6 smg1-2 and dgr14-1 to remove the kif6 mutation. There is no apparent growth or motility defect.

smg1-2: Mis-sense mutation at chromosome_13:1417593 (G > T)
dgr14-1: 33 kb deletion on chromosome_11: 3603615 – 3636297


Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)


  • Locus:
  • SMG1, DGR14
  • Chromosome:
  • 13, 11

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated from a cross between kif6 smg1-2 and fra10-1 to remove the kif6 mutation. There is no apparent growth or motility defect.

smg1-2: Mis-sense mutation at chromosome_13:1417593 (G > T)
fra10-1: Deletion at chromosome_7:3538004 (deletion of C)


Lin H, Zhang Z, Iomini C, Dutcher SK (2018) Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii. Open Biol. vol.8(3)


  • Locus:
  • SMG1, FRA10
  • Chromosome:
  • 13, 7

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

The origin of this strain is from a spontaneous mutation found in the strain CC-4348, which contains multiple mutations on various genes. The fla11-2 mutant is aflagellate.

An insertion into the exon 2 of IFT172 at chromosome_17: 1081293


Lin H, Guo S, Dutcher SK (2018) RPGRIP1L helps to establish the ciliary gate for entry of proteins. J Cell Sci. Oct 26;131(20)

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

The mutant phenotype of fla11-2 was rescued by introducing the transgene through a cross between fla11-2 and IFT172-FLAG.

Notes:
Wild-type IFT172 tagged with a 3xFLAG tag at the N-terminus
The tagged plasmid was transformed into wild-type cells


Lin H, Guo S, Dutcher SK (2018) RPGRIP1L helps to establish the ciliary gate for entry of proteins. J Cell Sci. Oct 26;131(20)

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by a cross between fla11-2 IFT172-FLAG and CC-5116 (NPHP4-HAN). This strain has normal flagellar assembly.

Notes:
Wild-type IFT172 tagged with a 3xFLAG tag at the N-terminus


Lin H, Guo S, Dutcher SK (2018) RPGRIP1L helps to establish the ciliary gate for entry of proteins. J Cell Sci. Oct 26;131(20)

From Huawen Lin, Susan Dutcher lab, Washington University in St. Louis, February 2019

This strain was generated by a cross between fla11-2 IFT172-FLAG and CC-5116 (NPHP4-HAN). This strain is aflagellate.

Notes:
Wild-type IFT172 tagged with a 3xFLAG tag at the N-terminus


Lin H, Guo S, Dutcher SK (2018) RPGRIP1L helps to establish the ciliary gate for entry of proteins. J Cell Sci. Oct 26;131(20)