From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a UVR8 disruption strain, generated with CRISPR/Cas9.

Background strain                 CC-125 mt+
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAPHVIII (pPH75)
Target gene                              UVR8, Cre05.g230600
Target sequence                     CGGCGTCACAGTGACGAGTGTGG

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a UVR8 disruption strain, generated with CRISPR/Cas9.

Background strain                 CC-125 mt+
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAPHVIII (pPH75)
Target gene                              UVR8, Cre05.g230600
Target sequence                     CGGCGTCACAGTGACGAGTGTGG (Exon 6)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

From Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a COP5 disruption strain, generated with CRISPR/Cas9.

Background strain                 CC-125 mt+
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAphVII (pPH360)
Target gene                              COP5, Cre02.g074150
Target sequence                     GCAGCACCTCCAGACTGACGCGG (Exon g6)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a PHOT/ UVR8 double disruption strain, generated with CRISPR/Cas9.

Background strain  CC-5440 ∆UVR8-I8-E4 (based on CC-3403)
Nuclease                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                       pAPHVIII (pPH75)
Target gene              PHOT, Cre03.g199000
Target sequence     GACTGGATATGGACCCGATGAGG (Exon 2)

 

CC-5440 ∆UVR8-I8-E4 mt- [PH050] strain info:
Marker                       pArg
Target gene              UVR8, Cre05.g230600
Target sequence     CGAGGACAGATCTACAGCTGGGG (Exon2)

  

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a PHOT/ UVR8 double disruption strain, generated with CRISPR/Cas9.

Background strain  CC-5440 ∆UVR8-I8-E4 (based on CC-3403)
Nuclease                  (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                       pAPHVIII (pPH75)
Target gene              PHOT, Cre03.g199000
Target sequence     GACTGGATATGGACCCGATGAGG (Exon 2)

 

CC-5440 ∆UVR8-I8-E4 mt- [PH050] strain info:
Marker                       pArg
Target gene              UVR8, Cre05.g230600
Target sequence     CGAGGACAGATCTACAGCTGGGG (Exon2)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December

This is a PHOT/ UVR8 double disruption strain, generated with CRISPR/Cas9.

Background strain   CC-5392 ∆PHOT-B5 [PH15] (based on CC-125)
Nuclease                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                       pAPHVIII (pPH75)
Target gene              UVR8, Cre05.g230600
Target sequence     CGGCGTCACAGTGACGAGTGTGG (Exon 6)

 

CC-5392 ∆PHOT-B5 [PH15] strain info:
Marker                       pAphVII (pPH360)
Target gene              PHOT, Cre03.g199000
Target sequence     GCGCATCCTCAACTACACCAAGG (Exon 6)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a PHOT/ UVR8 double disruption strain, generated with CRISPR/Cas9.

Background strain   CC-5392 ∆PHOT-B5 [PH15] (based on CC-125)
Nuclease                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                       pAPHVIII (pPH075)
Target gene              UVR8, Cre05.g230600
Target sequence     CGGCGTCACAGTGACGAGTGTGG (Exon 6)

 

CC-5392 ∆PHOT-B5 [PH15] strain info:
Marker                       pAphVII (pPH360)
Target gene              PHOT, Cre03.g199000
Target sequence     GCGCATCCTCAACTACACCAAGG (Exon 6)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

From Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a COP5 disruption strain, generated with CRISPR/Cas9.

Background strain                 CC-125 mt+
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAPHVIII (pIS105)
Target gene                              COP5, Cre02.g074150
Target sequence                     GCAGCACCTCCAGACTGACGCGG (Exon 6)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9. Plant Cell 29:2498-2518

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, January 2019

This is a 2-LOG disruption strain, generated with CRISPR/Cas9.

Background strain                  CC-125 mt+
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAPHVIII (pPH75)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, December 2018

This is a 2-LOG disruption strain, generated with CRISPR/Cas9.

Background strain                  CC-125 mt+
Nuclease                                   (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                       pAPHVIII (pPH75)

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.