Strains Archives - Page 111 of 126 - Chlamydomonas Resource Center

* The listed price of $30.00 for cultures and plasmids is for academic and non-profit users. Commercial and industrial users are charged $300.00 for each strain or plasmid and twice the listed price for media components. BACs and fosmids are $50.00 for academic and non-profit users and $500 for commercial/industry. For the Jonikas CLiP mutants, the price is $100.00 each for academic and non-profit users and commercial and industrial users are charged $1000.00. Subscriptions cannot be used for CLiP mutants, BACs nor fosmids.

CC-5493 IFT140-G/IFT20-mC mt+

$30.00

From Tyler Picariello, George Witman lab, University of Massachusetts Medical School, February 2019

Picariello T, Brown JM, Hou Y, Swank G, Cochran DA, King OD, Lechtreck K, Pazour GJ, Witman GB (2019) A global analysis of IFT-A function reveals specialization for transport of membrane-associated proteins into cilia. J Cell Sci. Feb 11;132(3)

Locus:
IFT140
Chromosome:
8

CC-5494 IFT140ΔWD-G/IFT20-mC mt+

$30.00

From Tyler Picariello, George Witman lab, University of Massachusetts Medical School, February 2019

Locus:
IFT140
Chromosome:
8

CC-5495 TGSM1-PD1::GSM1 diploid mt+

$30.00

From Jae-Hyeok Lee, University of British Columbia, March 2019

Kariyawasam T, Hoo S, Goodenough U, Lee JH (2019) Novel approaches for generating and manipulating diploid strains of Chlamydomonas reinhardtii. Algae. 34:35-43

CC-5496 TGSP1-PD1::GSP1 diploid mt+

$30.00

From Jae-Hyeok Lee, University of British Columbia, March 2019

Kariyawasam T, Hoo S, Goodenough U, Lee JH (2019) Novel approaches for generating and manipulating diploid strains of Chlamydomonas reinhardtii. Algae. 34:35-43

CC-5497 MD1-homo mt- (diploid homozygous for MT (MT-/MT-))

$30.00

From Jae-Hyeok Lee, University of British Columbia, March 2019

Kariyawasam T, Hoo S, Goodenough U, Lee JH (2019) Novel approaches for generating and manipulating diploid strains of Chlamydomonas reinhardtii. Algae. 34:35-43

CC-5498 iso1D-HETD1 mt- (Isoagglutinating diploid heterozygous for iso1 and MT)

$30.00

From Jae-Hyeok Lee, University of British Columbia, March 2019

Kariyawasam T, Hoo S, Goodenough U, Lee JH (2019) Novel approaches for generating and manipulating diploid strains of Chlamydomonas reinhardtii. Algae. 34:35-43

CC-5499 ∆ChR1 ∆ChR2 [PH128]

$30.00

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, March 2019

This is a ChR1 /ChR2 disruption strain, generated with CRISPR/Cas9.

Background strain :    CC-125
Nuclease:                               (Sp)Cas9 as ribonucleoprotein (RNP)
Marker:                                  pAPHVIII (p114), pAPHVII (p360)
Target gene:                          ChR1 (COP3), Cre14.g611300
ChR2 (COP4), Cre02.g085257
Target sequence : ChR1: TGTGGCTTCGTTACGCGGAGTGG (Exon5)
ChR2: GCTCGCGCCCAACGGCACTCAGG (Exon1)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Locus:
ChR1, ChR2
Chromosome:
14, 2

CC-5500 d1blic::D1bLIC-crCherry mt- [21B7]

$30.00

From Mary Porter, University of Minnesota, March 2019

The original T8D9 background strain contains an insertion in the D1bLIC gene on chromosome 9 that results in defective retrograde IFT and short flagella. In this strain, the d1blic mutation was rescued with a codon optimized-Cherry tagged D1bLIC gene that restores wild-type flagellar length and retrograde IFT.

Background: CC-4487 d1blic [T8D9]
Origin: d1blic mt- was co-transformed with D1bLIC-crCherry and pSI103, selected on paromomycin, and screened for recovery of full-length flagella
Culture maintenance: Well-flagellated cells require culture in dilute media with rocking or aeration for either 2-4 hours in M-N/5 or overnight in TAP
Comment: Rescued cells are paralyzed with some wiggling due to a second, uncharacterized mutation in the original T8D9 strain, but the tagged D1bLIC gene rescues the short flagellar phenotype associated with the d1blic mutation

Perrone CA, Tritschler D, Taulman P, Bower R, Yoder BK, Porter ME (2003) A novel dynein light intermediate chain colocalizes with the retrograde motor for intraflagellar transport at sites of axoneme assembly in chlamydomonas and Mammalian cells. Mol Biol Cell. 14:2041-56
Reck J, Schauer AM, VanderWaal Mills K, Bower R, Tritschler D, Perrone CA, Porter ME (2016) The role of the dynein light intermediate chain in retrograde IFT and flagellar function in Chlamydomonas. Mol Biol Cell. 27:2404-22
Chien A, Shih SM, Bower R, Tritschler D, Porter ME, Yildiz A (2017) Dynamics of the IFT machinery at the ciliary tip. Elife. Sep 20;6

CC-5501 d1blic::D1bLIC-GFP mt-

$30.00

From Mary Porter, University of Minnesota, March 2019

Background: CC-4054, d1blic, mt- (YH43)
Origin: The d1blic (YH43) was co-transformed with pSI103 and a wild-type D1bLIC transgene containing a GFP tag at its carboxy-terminus, selected on paromomycin, and screened for recovery of full-length flagella and expression of D1bLIC-GFP.
Culture maintenance: no special treatment
Comment: The D1bLIC-GFP gene restores full-length flagella and retrograde IFT.

Hou Y, Pazour GJ, Witman GB (2004) A dynein light intermediate chain, D1bLIC, is required for retrograde intraflagellar transport. Mol Biol Cell. 15:4382-94
Reck J, Schauer AM, VanderWaal Mills K, Bower R, Tritschler D, Perrone CA, Porter ME (2016) The role of the dynein light intermediate chain in retrograde IFT and flagellar function in Chlamydomonas. Mol Biol Cell. 27:2404-22

CC-5502 d1blic::D1bLIC-crCherry KAP-GFP mt- [C5]

$30.00

From Mary Porter, University of Minnesota, March 2019

The original T8D9 background strain contains an insertion in the D1bLIC gene on chromosome 9 that results in defective retrograde IFT and short flagella. This strain contains two transgenes, D1bLIC-crCherry and KAP-GFP.

Background: CC-4487 d1blic [T8D9]
Origin: The D1bLIC-crCherry strain was co-transformed with pHyg3 and KAP-GFP, selected on hygromycin, and screened for the presence of KAP-GFP by fluorescence microscopy
Culture maintenance: Well-flagellated cells require culture in dilute media with rocking or aeration for either 2-4 hours in M-N/5 or overnight in TAP
Comment: The host D1bLIC rescued cells are paralyzed with some wiggling due to the second, uncharacterized mutation in the original T8D9 strain. The KAP-GFP transgene is expressed at the same level as the endogenous wild-type KAP protein.

Mueller J, Perrone CA, Bower R, Cole DG, Porter ME (2005) The FLA3 KAP subunit is required for localization of kinesin-2 to the site of flagellar assembly and processive anterograde intraflagellar transport. Mol Biol Cell. 16:1341-54
Chien A, Shih SM, Bower R, Tritschler D, Porter ME, Yildiz A (2017) Dynamics of the IFT machinery at the ciliary tip. Elife. Sep 20;6

CC-5510 pf2-4::DRC4-crCherry mt- [1-4]

$30.00

From Mary Porter, University of Minnesota, March 2019

CC-4483 pf2-4 was co-transformed with pSI103 and a wild-type copy of the DRC4 gene containing a codon optimized Cherry tag at its carboxy-terminus, selected on paromomycin, and screened for recovery of wild-type motility. The pf2-4 mutation in the DRC4 gene on chromosome 6 was rescued.

Rupp G, Porter ME. A subunit of the dynein regulatory complex in Chlamydomonas is a homologue of a growth arrest-specific gene product. J Cell Biol. 2003 Jul 7;162(1):47-57. doi: 10.1083/jcb.200303019. PMID: 12847082; PMCID: PMC2172716.

Saravanan S, Trischler D, Bower R, Porter M, Lechtreck K. In vivo imaging reveals independent intraflagellar transport of the nexin-dynein regulatory complex subunits DRC2 and DRC4. Mol Biol Cell. 2023 Feb 1;34(2):br2. doi: 10.1091/mbc.E22-11-0524. Epub 2023 Jan 4. PMID: 36598807; PMCID: PMC9930527.

Locus:
PF2
Chromosome:
6

CC-5511 bop5-2 mt- [6F5, 7B]

$30.00

From Mary Porter, University of Minnesota, March 2019

CC-4284 bop5-2 (6F5) mt+ was crossed to CC-4264 apml-19 nit1 mt- [Tam L8] to recover bop5-2 in a mt- background. The original bop5-2 strain contains an insertion of the NIT1 gene in the BOP5 locus on chromosome 12. This strain is difficult to flagellate – resuspend in minimal medium or use aeration.
The insertion of the NIT1 gene is associated with a large deletion that removes most of the BOP5 locus and extends into neighboring genes. There is also another uncharacterized mutation that results in a move backwards only (mbo) phenotype.

Bower R, VanderWaal K, O'Toole E, Fox L, Perrone C, Mueller J, Wirschell M, Kamiya R, Sale WS, Porter ME (2009) IC138 defines a subdomain at the base of the I1 dynein that regulates microtubule sliding and flagellar motility. Mol Biol Cell. 20:3055-63
VanderWaal KE, Yamamoto R, Wakabayashi K, Fox L, Kamiya R, Dutcher SK, Bayly PV, Sale WS, Porter ME (2011) bop5 Mutations reveal new roles for the IC138 phosphoprotein in the regulation of flagellar motility and asymmetric waveforms. Mol Biol Cell. 22:2862-74
Heuser T, Barber CF, Lin J, Krell J, Rebesco M, Porter ME, Nicastro D (2012) Cryoelectron tomography reveals doublet-specific structures and unique interactions in the I1 dynein. Proc Natl Acad Sci U S A. 109:E2067-76

Locus:
BOP5 [IC138]
Chromosome:
12

CC-5514 ida6-1 IDA6-GFP pf2-4 (2D x 2D)

$30.00

From Mary Porter, University of Minnesota, March 2019

pf2-4 DRC4-crCherry mt- was mated to ida6 DRC2-GFP mt+

The pf2-4 mutation was generated by insertion of the NIT1 gene in the PF2 locus on chromosome 11. The ida6-1 mutation was generated by UV mutagenesis of the IDA6 locus on chromosome 13.

Locus:
IDA6, PF2
Chromosome:
13, 11

CC-5515 ida6-1 pf2-4 PF2-crCherry (5D x D)

$30.00

From Mary Porter, University of Minnesota, March 2019

pf2-4 DRC4-crCherry mt- was mated to ida6 DRC2-GFP mt+

The pf2-4 mutation was generated by insertion of the NIT1 gene in the PF2 locus on chromosome 11. The ida6-1 mutation was generated by UV mutagenesis of the IDA6 locus on chromosome 1

Locus:
IDA6, PF2
Chromosome:
13, 11

CC-5516 pf2-4 ida6-1 DRC4-crCherry DRC2-GFP mt- (6D x D)

$30.00

From Mary Porter, University of Minnesota, March 2019

pf2-4 DRC4-crCherry mt- was mated to ida6 DRC2-GFP mt+

The pf2-4 mutation was generated by insertion of the NIT1 gene in the PF2 locus on chromosome 11. The ida6-1 mutation was generated by UV mutagenesis of the IDA6 locus on chromosome 1

Locus:
IDA6, PF2
Chromosome:
13, 11

CC-5517 pf2-4 ida6-1 DRC4-crCherry DRC2-GFP mt+ (16D x D)

$30.00

From Mary Porter, University of Minnesota, March 2019

pf2-4 DRC4-crCherry mt- was mated to ida6 DRC2-GFP mt+

The pf2-4 mutation was generated by insertion of the NIT1 gene in the PF2 locus on chromosome 11. The ida6-1 mutation was generated by UV mutagenesis of the IDA6 locus on chromosome 1

Locus:
IDA6, PF2
Chromosome:
13, 11

CC-5519 dhc1b (temperature sensitive)

$30.00

From Nathan McNeill, George Witman lab, University of Massachusetts Medical School, April 2019

Permissive temperature: 18C – flagella are variable but have average length of one half of wild type.
Non-permissive temperature: 32C – flagella shorten rapidly, average less than half of original length.

Aternate name is dhc1b-2, so as to distinguish it from dhc1b-3. dhc1b-ts and dhc1b-2 are aliases; Lechtreck et al 2009 and Witman 2012 used the former; Lechtreck et al. 2013 used the latter.

Lechtreck KF, Johnson EC, Sakai T, Cochran D, Ballif BA, Rush J, Pazour GJ, Ikebe M, Witman GB (2009) The Chlamydomonas reinhardtii BBSome is an IFT cargo required for export of specific signaling proteins from flagella. J Cell Biol. 187:1117-32

Lechtreck KF, Brown JM, Sampaio JL, Craft JM, Shevchenko A, Evans JE, Witman GB (2013) Cycling of the signaling protein phospholipase D through cilia requires the BBSome only for the export phase. J Cell Biol. 201:249-61

Witman, G. B. 2012. Dynein and intraflagellar transport. In: Dyneins: Structure, Biology and Disease (ed. S. M. King). Elsevier, New York, NY. pp. 395-421

CC-5520 wdr92-1 tpg1-2

$30.00

From Steven King, University of Connecticut Health Center, June 2019

The original wdr92-1 mutation came from the CLiP library strain LMJ.RY0402.137495 and was crossed to tpg1-2 by Dr Susan Dutcher.

The strain grows in all standard media (M, R and TAP) and contains a paromomycin resistance cassette in the wdr92 gene. It has a cell wall and makes >7 um long flaccid/floppy flagella that lack all dynein arms.

Patel-King RS, Sakato-Antoku M, Yankova M, King SM. WDR92 Is Required for Axonemal Dynein Heavy Chain Stability in Cytoplasm. Mol Biol Cell. 2019 May 22:mbcE19030139. doi: 10.1091/mbc.E19-03-0139. [Epub ahead of print] PubMed PMID: 31116681.

Locus:
WRD92, TPG1
Chromosome:
16, 17