Strains

From Lei Zhao and George Witman, University of Massachusetts Medical School, August 2019

This strain was generated by transformation of dpy30-1 with the plasmid pBC24 containing wild-type DPY30 genomic sequence with a 3xHA tag; this plasmid also contains a hygromycin-resistance cassette (Berthold et al., 2002, Protist).

Zhao L, Hou YQ, Picariello T, Craige B, Witman GB (2019) Proteome of the central apparatus of a ciliary axoneme. J Cell Biol. 218: 2051-2070

  • Locus:
  • DPY30
  • Chromosome:
  • 6

From Susan Dutcher, Washington University in St. Louis, October 2019

This strain was generated from two rounds of backcrosses of insertional mutant LMJ.RY0401.157050 to CC-125 or CC-124. Used to examine RNA and proteomics of the bop2 locus.

Bustamante-Marin XM, Horani A, Stoyanova M, Charng W-L, Bottier M, Sears PR, Daniels LA, Bowen H, Conrad DF, Knowles MR, Ostrowski LE, Zariwala MA, Dutcher SK (2019) Mutation of CFAP57 causes primary ciliary dyskinesia by disrupting the asymmetric targeting of a subset of ciliary inner dynein arms. bioRxiv 773028; doi: https://doi.org/10.1101/773028

  • Locus:
  • FAP57
  • Chromosome:
  • 4

From Susan Dutcher, Washington University in St. Louis, October 2019

This strain was generated from two rounds of backcrosses of insertional mutant LMJ.RY0401.107706 to CC-125 or CC-124 and used to examine RNA and proteomics.

Bustamante-Marin XM, Horani A, Stoyanova M, Charng W-L, Bottier M, Sears PR, Daniels LA, Bowen H, Conrad DF, Knowles MR, Ostrowski LE, Zariwala MA, Dutcher SK (2019) Mutation of CFAP57 causes primary ciliary dyskinesia by disrupting the asymmetric targeting of a subset of ciliary inner dynein arms. bioRxiv 773028; doi: https://doi.org/10.1101/773028

  • Locus:
  • FAP57
  • Chromosome:
  • 4

From Susan Dutcher, Washington University in St. Louis, October 2019

This strain was generated from two rounds of backcrosses of insertional mutant LMJ.RY0401.107706 to CC-125 or CC-124 and used to examine RNA and proteomics.

Bustamante-Marin XM, Horani A, Stoyanova M, Charng W-L, Bottier M, Sears PR, Daniels LA, Bowen H, Conrad DF, Knowles MR, Ostrowski LE, Zariwala MA, Dutcher SK (2019) Mutation of CFAP57 causes primary ciliary dyskinesia by disrupting the asymmetric targeting of a subset of ciliary inner dynein arms. bioRxiv 773028; doi: https://doi.org/10.1101/773028

  • Locus:
  • FAP57
  • Chromosome:
  • 4

From Susan Dutcher, Washington University in St. Louis, October 2019

This strain was generated from two rounds of backcrosses of LMJ.RY0402.153393 to CC-125 or CC-124. It was examined by single particle Cryo EM to show loss of RIB72 protein and other proteins. mRNA after the insertion is missing.

Bustamante-Marin XM, Horani A, Stoyanova M, Charng W-L, Bottier M, Sears PR, Daniels LA, Bowen H, Conrad DF, Knowles MR, Ostrowski LE, Zariwala MA, Dutcher SK (2019) Mutation of CFAP57 causes primary ciliary dyskinesia by disrupting the asymmetric targeting of a subset of ciliary inner dynein arms. bioRxiv 773028; doi: https://doi.org/10.1101/773028

  • Locus:
  • RIB72
  • Chromosome:
  • 2

From Susan Dutcher, Washington University in St. Louis, October 2019

This strain was generated from two rounds of backcrosses of LMJ.RY0402.040835 to CC-125 or CC-124. It was examined by single particle Cryo EM to show loss of RIB72 protein and other proteins. mRNA after the insertion is missing.

Bustamante-Marin XM, Horani A, Stoyanova M, Charng W-L, Bottier M, Sears PR, Daniels LA, Bowen H, Conrad DF, Knowles MR, Ostrowski LE, Zariwala MA, Dutcher SK (2019) Mutation of CFAP57 causes primary ciliary dyskinesia by disrupting the asymmetric targeting of a subset of ciliary inner dynein arms. bioRxiv 773028; doi: https://doi.org/10.1101/773028

  • Locus:
  • RIB72
  • Chromosome:
  • 2

From Susan Dutcher, Washington University in St. Louis, October 2019

This strain was generated from two rounds of backcrosses of LMJ.RY0402.238057 to CC-125 or CC-124. It was examined by single particle Cryo EM to show loss of FAP166. mRNA after the insertion is missing.

Bustamante-Marin XM, Horani A, Stoyanova M, Charng W-L, Bottier M, Sears PR, Daniels LA, Bowen H, Conrad DF, Knowles MR, Ostrowski LE, Zariwala MA, Dutcher SK (2019) Mutation of CFAP57 causes primary ciliary dyskinesia by disrupting the asymmetric targeting of a subset of ciliary inner dynein arms. bioRxiv 773028; doi: https://doi.org/10.1101/773028

  • Locus:
  • FAP166
  • Chromosome:
  • 3

Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019

This is a 4-IPT disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: 4-IPT, Cre17.g717350
Target sequence: GGTGATTGTGACGGGGCCCA CGG (Exon 1)

This strain was generated in a collaboration with Prof. Thomas Roitsch.

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

  • Locus:
  • 4-IPT
  • Chromosome:
  • 17

Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019

This is a 4-IPT disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: 4-IPT, Cre17.g717350
Target sequence: GGTGATTGTGACGGGGCCCA CGG (Exon 1)

This strain was generated in a collaboration with Prof. Thomas Roitsch.

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

  • Locus:
  • 4-IPT
  • Chromosome:
  • 17

Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019

This is a CiliK (GCLK1) disruption strain, generated with CRISPR/Cas9. 

Background strain: SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: CiliK/GCLK1, Cre02.g104450
Target sequence: CCGGGATTCGAAGCGACGGA CGG (exon 1)

This strain was generated in a collaboration with Prof. William Snell.

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

  • Locus:
  • CiliK/GCLK1
  • Chromosome:
  • 2

Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019

This is a CiliK (GCLK1) disruption strain, generated with CRISPR/Cas9. 

Background strain: SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: CiliK/GCLK1, Cre02.g104450
Target sequence: CCGGGATTCGAAGCGACGGA CGG (exon 1)

This strain was generated in a collaboration with Prof. William Snell.

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

  • Locus:
  • CiliK/GCLK1
  • Chromosome:
  • 2

Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019

This is a CAV2 disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-5075 mt+ (sequence verified clone of CC-125)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: CAV2, Cre16.g665050
Target sequence: GGCGTACCGTCAATCAGCAT GGG (exon 5)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

  • Locus:
  • CAV2
  • Chromosome:
  • 16

Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019

This is a CAV2 disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-5075 mt+ (sequence verified clone of CC-125)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: CAV2, Cre16.g665050
Target sequence: GGCGTACCGTCAATCAGCAT GGG (exon 5)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

  • Locus:
  • CAV2
  • Chromosome:
  • 16

Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019

This is a ChR1 disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-3403 mt-
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pARG (pHR11)
Target gene: ChR1, Cre14.g611300
Target sequence: TGTGGCTTCGTTACGCGGAG TGG (exon 5)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

  • Locus:
  • ChR1
  • Chromosome:
  • 14

Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019

This is a ChR1 disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-3403 mt-
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pARG (pHR11)
Target gene: ChR1, Cre14.g611300
Target sequence: TGTGGCTTCGTTACGCGGAG TGG (exon 5)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

  • Locus:
  • ChR1
  • Chromosome:
  • 14

Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019

This is a ChR2 disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-3403 mt-
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pARG (pHR11)
Target gene: ChR2, Cre02.g085257
Target sequence: AGTGGTTGCGTTACGCCGAG TGG (exon 6)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

  • Locus:
  • ChR2
  • Chromosome:
  • 2

Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019

This is a ChR2 disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-3403 mt-
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pARG (pHR11)
Target gene: ChR2, Cre02.g085257
Target sequence: AGTGGTTGCGTTACGCCGAG TGG (exon 6)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

  • Locus:
  • ChR2
  • Chromosome:
  • 2

Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019

This is a ChR1 disruption strain, generated with CRISPR/Cas9. 

Background strain: SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: ChR1, Cre14.g611300
Target sequence: TGTGGCTTCGTTACGCGGAG TGG (exon 5)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

  • Locus:
  • ChR1
  • Chromosome:
  • 14

Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019

This is a ChR1 disruption strain, generated with CRISPR/Cas9. 

Background strain: SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: ChR1, Cre14.g611300
Target sequence: TGTGGCTTCGTTACGCGGAG TGG (exon 5)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

  • Locus:
  • ChR1
  • Chromosome:
  • 14

Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2019

This is a ChR2 disruption strain, generated with CRISPR/Cas9. 

Background strain: SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: ChR2, Cre02.g085257
Target sequence: AGTGGTTGCGTTACGCCGAG TGG (exon 6)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

  • Locus:
  • ChR2
  • Chromosome:
  • 2

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, November 2019

This is a ChR1 ChR2 disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
pAphVII (pPH360)
Target gene: ChR1, Cre14.g611300
ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG TGG (ChR1, exon 5)
GCTCGCGCCCAACGGCACTC AGG (ChR2, exon 1)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

  • Locus:
  • ChR1, ChR2
  • Chromosome:
  • 14, 2

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, November 2019

This is a ChR1 ChR2 disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
pAphVII (pPH360)
Target gene: ChR1, Cre14.g611300
ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG TGG (ChR1, exon 5)
CTATGTGTGCGCTATCGAGG TGG (ChR2, exon 4)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

  • Locus:
  • ChR1, ChR2
  • Chromosome:
  • 14, 2

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, November 2019

This is a ChR1 ChR2 disruption strain, generated with CRISPR/Cas9. 

Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
pAphVII (pPH360)
Target gene: ChR1, Cre14.g611300
ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG TGG (ChR1, exon 5)
CTATGTGTGCGCTATCGAGG TGG (ChR2, exon 4)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

  • Locus:
  • ChR1, ChR2
  • Chromosome:
  • 14, 2

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, November 2019

This is a ChR1 ChR2 disruption strain, generated with CRISPR/Cas9 and Zinc-finger nuclease. 

Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Zinc-finger nuclease (ZFN)
Marker: pAPHVIII (pPH75)
pAphVII (pPH360)
Target gene: ChR1, Cre14.g611300
ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG TGG (ChR1, exon 5)
CTATGTGTGCGCTATCGAGG TGG (ChR2, exon 4)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

  • Locus:
  • ChR1, ChR2
  • Chromosome:
  • 14, 2

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, November 2019

This is a ChR1 ChR2 disruption strain, generated with CRISPR/Cas9 and Zinc-finger nuclease. 

Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Zinc-finger nuclease (ZFN)
Marker: pAPHVIII (pPH75)
pAphVII (pPH360)
Target gene: ChR1, Cre14.g611300
ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG TGG (ChR1, exon 5)
CTATGTGTGCGCTATCGAGG TGG (ChR2, exon 4)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

  • Locus:
  • ChR1, ChR2
  • Chromosome:
  • 14, 2

From Erin Dymek, Elizabeth Smith lab, Dartmouth College, November 2019

Smith EF & Lefebvre PA (1996) PF16 encodes a protein with armadillo repeats and localizes to a single microtubule of the central apparatus in Chlamydomonas flagella. J Cell Biol. 132:359-70

  • Locus:
  • PF16
  • Chromosome:
  • 9

From Erin Dymek, Elizabeth Smith lab, Dartmouth College, November 2019

Smith EF & Lefebvre PA (1996) PF16 encodes a protein with armadillo repeats and localizes to a single microtubule of the central apparatus in Chlamydomonas flagella. J Cell Biol. 132:359-70

  • Locus:
  • PF16
  • Chromosome:
  • 9

From Erin Dymek, Elizabeth Smith lab, Dartmouth College, November 2019

Smith EF & Lefebvre PA (1997) PF20 gene product contains WD repeats and localizes to the intermicrotubule bridges in Chlamydomonas flagella. Mol Biol Cell. 8:455-67

  • Locus:
  • PF20
  • Chromosome:
  • 4

From Erin Dymek, Elizabeth Smith lab, Dartmouth College, November 2019

Smith EF & Lefebvre PA (1997) PF20 gene product contains WD repeats and localizes to the intermicrotubule bridges in Chlamydomonas flagella. Mol Biol Cell. 8:455-6

  • Locus:
  • PF20
  • Chromosome:
  • 4

From Erin Dymek, Elizabeth Smith lab, Dartmouth College, November 2019

Dymek EE, Lefebvre PA, Smith EF (2004) PF15p is the chlamydomonas homologue of the Katanin p80 subunit and is required for assembly of flagellar central microtubules. Eukaryot Cell. 3:870-9

  • Locus:
  • PF15 [KAT2]
  • Chromosome:
  • 3