Plasmids
From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin October 2017
Cloning vector for Streptococcus pyogenes Cas9 (SpCas9) single guide RNA transcription, controlled by the U6 snRNA promoter #4 (3’ of Cre15.g640800). The 20 bp target site can be inserted in a cut-ligation reaction as annealed oligos into an Esp3I cloning site following the protocol of Ann Ran (Ran et al. 2013). The immediate 4-bp sequence upstream of the transcriptional start site was changed to ACTT in all U6 constructs to simplify the cloning procedures.
Host strain: DH10b
Selection in E. coli: ampicillin
Link to sequence and map
Sequence (.docx file)
Overview of all CRISPR/Cas9 plasmids from the Hegemann lab
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
Greiner, A., Kelterborn, S., Evers, H., Kreimer, G., Sizova, I., and Hegemann, P. Targeting of photoreceptor genes via zinc-finger nucleases and CRISPR/Cas9 in Chlamydomonas reinhardtii. Plant Cell 30 (2017). https://doi.org/10.1105/tpc.17.00659
Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F (2013) Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 8:2281-2308
From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin October 2017
Cloning vector for Streptococcus pyogenes Cas9 (SpCas9) single guide RNA transcription, controlled by the U6 snRNA promoter #4 (3’ of Cre15.g640800). The 20 bp target site can be inserted in a cut-ligation reaction as annealed oligos into an Esp3I cloning site following the protocol of Ann Ran (Ran et al. 2013). The immediate 4-bp sequence upstream of the transcriptional start site was changed to ACTT in all U6 constructs to simplify the cloning procedures.
Host strain: XL1-Blue
Selection in E. coli: ampicillin
Link to sequence and map
Sequence (.docx file)
Overview of all CRISPR/Cas9 plasmids from the Hegemann lab
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
Greiner, A., Kelterborn, S., Evers, H., Kreimer, G., Sizova, I., and Hegemann, P. Targeting of photoreceptor genes via zinc-finger nucleases and CRISPR/Cas9 in Chlamydomonas reinhardtii. Plant Cell 30 (2017). https://doi.org/10.1105/tpc.17.00659
Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F (2013) Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 8:2281-2308
From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin October 2017
Vector for single guide RNA targeting the phytoene synthase gene PSY1 with RNA scaffold for Streptococcus pyogenes Cas9 (SpCas9), controlled by the U6 snRNA promoter #4. Vector contains an aphVIII cassette for selection on paromomycin.
Target: PSY1 (Cre02.g095092)
Protospacer: GCGCTGGATCTGGCCACGACCG
PAM: NGG
Selection in C. reinhardtii: paromomycin
Host strain: XL1-Blue
Selection in E. coli: ampicillin
Link to sequence and map
Sequence (.docx file)
Overview of all CRISPR/Cas9 plasmids from the Hegemann lab
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
Greiner, A., Kelterborn, S., Evers, H., Kreimer, G., Sizova, I., and Hegemann, P. Targeting of photoreceptor genes via zinc-finger nucleases and CRISPR/Cas9 in Chlamydomonas reinhardtii. Plant Cell 30 (2017). https://doi.org/10.1105/tpc.17.00659
From Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin October 2017
Cloning vector for Staphylococcus aureus Cas9 (SaCas9) guide RNA transcription, controlled by the U6 snRNA promoter #1 (5’ of Cre08.g377251). The 20 bp target site can be inserted in a cut-ligation reaction as annealed oligos into an Esp3I cloning site following the protocol of Ann Ran (Ran et al. 2013). The immediate 4-bp sequence upstream of the transcriptional start site was changed to ACTT in all U6 constructs to simplify the cloning procedures.
HindIII and KpnI restriction sites can be used for C. reinhardtii antibiotic resistance gene insertion (aphVII, aphVIII, ble).
Host strain: DH10b
Selection in E. coli: ampicillin
Link to sequence and map
Sequence (.docx file)
Overview of all CRISPR/Cas9 plasmids from the Hegemann lab
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
Greiner, A., Kelterborn, S., Evers, H., Kreimer, G., Sizova, I., and Hegemann, P. Targeting of photoreceptor genes via zinc-finger nucleases and CRISPR/Cas9 in Chlamydomonas reinhardtii. Plant Cell 30 (2017). https://doi.org/10.1105/tpc.17.00659
Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F (2013) Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 8:2281-2308
From Andre Greiner, Peter Hegemann lab, Humboldt University-Berlin October 2017
Cloning vector for Staphylococcus aureus Cas9 (SaCas9) guide RNA transcription, controlled by the U6 snRNA promoter #2. The 20 bp target site can be inserted in a cut-ligation reaction as annealed oligos into an Esp3I cloning site following the protocol of Ann Ran (Ran et al. 2013). The immediate 4-bp sequence upstream of the transcriptional start site was changed to ACTT in all U6 constructs to simplify the cloning procedures.
HindIII and KpnI restriction sites can be used for C. reinhardtii antibiotic resistance gene insertion (aphVII, aphVIII, ble).
Host strain: XL1-Blue
Selection in E. coli: ampicillin
Link to sequence and map
Sequence (.docx file)
Overview of all CRISPR/Cas9 plasmids from the Hegemann lab
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
Greiner, A., Kelterborn, S., Evers, H., Kreimer, G., Sizova, I., and Hegemann, P. Targeting of photoreceptor genes via zinc-finger nucleases and CRISPR/Cas9 in Chlamydomonas reinhardtii. Plant Cell 30 (2017). https://doi.org/10.1105/tpc.17.00659
Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F (2013) Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 8:2281-2308
From Andre Greiner, Peter Hegemann lab, Humboldt University-Berlin October 2017
Cloning vector for Staphylococcus aureus Cas9 (SaCas9) guide RNA transcription, controlled by the U6 snRNA promoter #3 (3’ of Cre08.g371751). The 20 bp target site can be inserted in a cut-ligation reaction as annealed oligos into an Esp3I cloning site following the protocol of Ann Ran (Ran et al. 2013). The immediate 4-bp sequence upstream of the transcriptional start site was changed to ACTT in all U6 constructs to simplify the cloning procedures.
HindIII and KpnI restriction sites can be used for C. reinhardtii antibiotic resistance gene insertion (aphVII, aphVIII, ble).
Host strain: XL1-Blue
Selection in E. coli: ampicillin
Link to sequence and map
Sequence (.docx file)
Overview of all CRISPR/Cas9 plasmids from the Hegemann lab
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
Greiner, A., Kelterborn, S., Evers, H., Kreimer, G., Sizova, I., and Hegemann, P. Targeting of photoreceptor genes via zinc-finger nucleases and CRISPR/Cas9 in Chlamydomonas reinhardtii. Plant Cell 30 (2017). https://doi.org/10.1105/tpc.17.00659
Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F (2013) Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 8:2281-2308
From Andre Greiner, Peter Hegemann lab, Humboldt University-Berlin October 2017
Cloning vector for Staphylococcus aureus Cas9 (SaCas9) guide RNA transcription, controlled by the U6 snRNA promoter #4 (3’ of Cre15.g640800). The 20 bp target site can be inserted in a cut-ligation reaction as annealed oligos into an Esp3I cloning site following the protocol of Ann Ran (Ran et al. 2013). The immediate 4-bp sequence upstream of the transcriptional start site was changed to ACTT in all U6 constructs to simplify the cloning procedures.
HindIII and KpnI restriction sites can be used for C. reinhardtii antibiotic resistance gene insertion (aphVII, aphVIII, ble).
Host strain: XL1-Blue
Selection in E. coli: ampicillin
Link to sequence and map
Sequence (.docx file)
Overview of all CRISPR/Cas9 plasmids from the Hegemann lab
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
Greiner, A., Kelterborn, S., Evers, H., Kreimer, G., Sizova, I., and Hegemann, P. Targeting of photoreceptor genes via zinc-finger nucleases and CRISPR/Cas9 in Chlamydomonas reinhardtii. Plant Cell 30 (2017). https://doi.org/10.1105/tpc.17.00659
Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F (2013) Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 8:2281-2308
From Andre Greiner, Peter Hegemann lab, Humboldt University-Berlin October 2017
Cloning vector for Staphylococcus aureus Cas9 (SaCas9) guide RNA transcription, controlled by the U6 snRNA promoter #4 (3’ of Cre15.g640800). The 20 bp target site can be inserted in a cut-ligation reaction as annealed oligos into an Esp3I cloning site following the protocol of Ann Ran (Ran et al. 2013). The immediate 4-bp sequence upstream of the transcriptional start site was changed to ACTT in all U6 constructs to simplify the cloning procedures.
Vector contains an aphVIII cassette for selection on paromomycin.
Selection in C. reinhardtii: paromomycin
Host strain: XL1-Blue
Selection in E. coli: ampicillin
Link to sequence and map
Sequence (.docx file)
Overview of all CRISPR/Cas9 plasmids from the Hegemann lab
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
Greiner, A., Kelterborn, S., Evers, H., Kreimer, G., Sizova, I., and Hegemann, P. Targeting of photoreceptor genes via zinc-finger nucleases and CRISPR/Cas9 in Chlamydomonas reinhardtii. Plant Cell 30 (2017). https://doi.org/10.1105/tpc.17.00659
Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F (2013) Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 8:2281-2308
From Andre Greiner, Peter Hegemann lab, Humboldt University-Berlin October 2017
Vector for guide RNA targeting the phytoene synthase gene PSY1 with scaffold for Staphylococcus aureus Cas9 (SaCas9), controlled by the U6 snRNA promoter #4. Vector contains an aphVIII cassette for selection on paromomycin.
Target: PSY1 (Cre02.g095092)
Protospacer: GCGCTGGATCTGGCCACGACCG
PAM: NGGRR
Selection in C. reinhardtii: paromomycin
Host strain: XL1-Blue
Selection in E. coli: ampicillin
Link to sequence and map
Sequence (.docx file)
Overview of all CRISPR/Cas9 plasmids from the Hegemann lab
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
Greiner, A., Kelterborn, S., Evers, H., Kreimer, G., Sizova, I., and Hegemann, P. Targeting of photoreceptor genes via zinc-finger nucleases and CRISPR/Cas9 in Chlamydomonas reinhardtii. Plant Cell 30 (2017). https://doi.org/10.1105/tpc.17.00659
pAphVII (pPH360)
$30.00
$30.00
From Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin October 2017
Streptomyces rimosus aminoglycoside phosphotransferase aphVII selection marker optimized to C. reinhardtii codon bias, controlled by the HSP70A/RBCS2 tandem promoter and RBCS2 3’ UTR.
Selection in C. reinhardtii: hygromycin B (10-40 μg/ml)
Host strain: XL1-Blue
Selection in E. coli: ampicillin (100 µg/ml)
Link to sequence and map (GenBank)
Sequence (.docx file)
Overview of all CRISPR/Cas9 plasmids from the Hegemann lab
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
Greiner, A., Kelterborn, S., Evers, H., Kreimer, G., Sizova, I., and Hegemann, P. Targeting of photoreceptor genes via zinc-finger nucleases and CRISPR/Cas9 in Chlamydomonas reinhardtii. Plant Cell 30 (2017). https://doi.org/10.1105/tpc.17.00659
pAphVIII (pPH075)
$30.00
$30.00
From Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin October 2017
Streptomyces rimosus aminoglycoside-5 ́- phosphotransferase aphVIII selection marker optimized to C. reinhardtii codon bias, controlled by the HSP70A/RBCS2 tandem promoter and RBCS2 3’ UTR.
Selection in C. reinhardtii: paromomycin (10-40 μg/ml)
Host strain: DH10b
Selection in E. coli: ampicillin (100 µg/ml)
Link to sequence and map (GenBank, updated 09/2019)
Sequence (.docx file)
Overview of all CRISPR/Cas9 plasmids from the Hegemann lab
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
Greiner, A., Kelterborn, S., Evers, H., Kreimer, G., Sizova, I., and Hegemann, P. Targeting of photoreceptor genes via zinc-finger nucleases and CRISPR/Cas9 in Chlamydomonas reinhardtii. Plant Cell 30 (2017). https://doi.org/10.1105/tpc.17.00659
pOpt2_mVenus_Paro
$30.00
$30.00
From Kyle Lauersen, Olaf Kruse lab, Bielefeld University-Germany, November 2017
Host strain: DH5α
Selection in E. coli: ampicillin
Selection in C. reinhardtii: paromomycin
Reporter: YFP
Wichmann J, Baier T, Wentnagel E, Lauersen KJ, Kruse O. Tailored carbon partitioning for phototrophic production of (E)-α-bisabolene from the green microalga Chlamydomonas reinhardtii. Metab Eng. 2017 Dec 16. pii: S1096-7176(17)30395-6. doi: 10.1016/j.ymben.2017.12.010. [Epub ahead of print]
pOpt2_mCerulean3_Paro
$30.00
$30.00
From Kyle Lauersen, Olaf Kruse lab, Bielefeld University-Germany, November 2017
Host strain: DH5α
Selection in E. coli: ampicillin
Selection in C. reinhardtii: paromomycin
Reporter: CFP
Wichmann J, Baier T, Wentnagel E, Lauersen KJ, Kruse O. Tailored carbon partitioning for phototrophic production of (E)-α-bisabolene from the green microalga Chlamydomonas reinhardtii. Metab Eng. 2017 Dec 16. pii: S1096-7176(17)30395-6. doi: 10.1016/j.ymben.2017.12.010. [Epub ahead of print]
pOpt2_gLuc_Paro
$30.00
$30.00
From Kyle Lauersen, Olaf Kruse lab, Bielefeld University-Germany, November 2017
Host strain: DH5α
Selection in E. coli: ampicillin
Selection in C. reinhardtii: paromomycin
Reporter: Gaussia princeps Luciferase
Wichmann J, Baier T, Wentnagel E, Lauersen KJ, Kruse O. Tailored carbon partitioning for phototrophic production of (E)-α-bisabolene from the green microalga Chlamydomonas reinhardtii. Metab Eng. 2017 Dec 16. pii: S1096-7176(17)30395-6. doi: 10.1016/j.ymben.2017.12.010. [Epub ahead of print]
pOpt2_Clover_Paro
$30.00
$30.00
From Kyle Lauersen, Olaf Kruse lab, Bielefeld University-Germany, November 2017
Host strain: DH5α
Selection in E. coli: ampicillin
Selection in C. reinhardtii: paromomycin
Reporter: GFP
Wichmann J, Baier T, Wentnagel E, Lauersen KJ, Kruse O. Tailored carbon partitioning for phototrophic production of (E)-α-bisabolene from the green microalga Chlamydomonas reinhardtii. Metab Eng. 2017 Dec 16. pii: S1096-7176(17)30395-6. doi: 10.1016/j.ymben.2017.12.010. [Epub ahead of print]
pOpt2_mRuby2_Paro
$30.00
$30.00
From Kyle Lauersen, Olaf Kruse lab, Bielefeld University-Germany, November 2017
Host strain: DH5α
Selection in E. coli: ampicillin
Selection in C. reinhardtii: paromomycin
Reporter: RFP
Wichmann J, Baier T, Wentnagel E, Lauersen KJ, Kruse O. Tailored carbon partitioning for phototrophic production of (E)-α-bisabolene from the green microalga Chlamydomonas reinhardtii. Metab Eng. 2017 Dec 16. pii: S1096-7176(17)30395-6. doi: 10.1016/j.ymben.2017.12.010. [Epub ahead of print]
From Kyle Lauersen, Olaf Kruse lab, Bielefeld University-Germany, November 2017
Host strain: DH5α
Selection in E. coli: ampicillin
Selection in C. reinhardtii: paromomycin
Reporter: Gaussia princeps Luciferase
Wichmann J, Baier T, Wentnagel E, Lauersen KJ, Kruse O. Tailored carbon partitioning for phototrophic production of (E)-α-bisabolene from the green microalga Chlamydomonas reinhardtii. Metab Eng. 2017 Dec 16. pii: S1096-7176(17)30395-6. doi: 10.1016/j.ymben.2017.12.010. [Epub ahead of print]
pOpt2_mVenus_Hyg
$30.00
$30.00
From Kyle Lauersen, Olaf Kruse lab, Bielefeld University-Germany, November 2017
Host strain: DH5α
Selection in E. coli: ampicillin
Selection in C. reinhardtii: hygromycin B
Reporter: YFP
Wichmann J, Baier T, Wentnagel E, Lauersen KJ, Kruse O. Tailored carbon partitioning for phototrophic production of (E)-α-bisabolene from the green microalga Chlamydomonas reinhardtii. Metab Eng. 2017 Dec 16. pii: S1096-7176(17)30395-6. doi: 10.1016/j.ymben.2017.12.010. [Epub ahead of print]
pOpt2_mCerulean3_Hyg
$30.00
$30.00
From Kyle Lauersen, Olaf Kruse lab, Bielefeld University-Germany, November 2017
Host strain: DH5α
Selection in E. coli: ampicillin
Selection in C. reinhardtii: hygromycin B
Reporter: CFP
Wichmann J, Baier T, Wentnagel E, Lauersen KJ, Kruse O. Tailored carbon partitioning for phototrophic production of (E)-α-bisabolene from the green microalga Chlamydomonas reinhardtii. Metab Eng. 2017 Dec 16. pii: S1096-7176(17)30395-6. doi: 10.1016/j.ymben.2017.12.010. [Epub ahead of print]
pOpt2_gLuc_Hyg
$30.00
$30.00
From Kyle Lauersen, Olaf Kruse lab, Bielefeld University-Germany, November 2017
Host strain: DH5α
Selection in E. coli: ampicillin
Selection in C. reinhardtii: hygromycin B
Reporter: Gaussia princeps Luciferase
Wichmann J, Baier T, Wentnagel E, Lauersen KJ, Kruse O. Tailored carbon partitioning for phototrophic production of (E)-α-bisabolene from the green microalga Chlamydomonas reinhardtii. Metab Eng. 2017 Dec 16. pii: S1096-7176(17)30395-6. doi: 10.1016/j.ymben.2017.12.010. [Epub ahead of print]
pOpt2_Clover_Hyg
$30.00
$30.00
From Kyle Lauersen, Olaf Kruse lab, Bielefeld University-Germany, November 2017
Host strain: DH5α
Selection in E. coli: ampicillin
Selection in C. reinhardtii: hygromycin B
Reporter: GFP
Wichmann J, Baier T, Wentnagel E, Lauersen KJ, Kruse O. Tailored carbon partitioning for phototrophic production of (E)-α-bisabolene from the green microalga Chlamydomonas reinhardtii. Metab Eng. 2017 Dec 16. pii: S1096-7176(17)30395-6. doi: 10.1016/j.ymben.2017.12.010. [Epub ahead of print]
pOpt2_mRuby2_Hyg
$30.00
$30.00
From Kyle Lauersen, Olaf Kruse lab, Bielefeld University-Germany, November 2017
Host strain: DH5α
Selection in E. coli: ampicillin
Selection in C. reinhardtii: hygromycin B
Reporter: RFP
Wichmann J, Baier T, Wentnagel E, Lauersen KJ, Kruse O. Tailored carbon partitioning for phototrophic production of (E)-α-bisabolene from the green microalga Chlamydomonas reinhardtii. Metab Eng. 2017 Dec 16. pii: S1096-7176(17)30395-6. doi: 10.1016/j.ymben.2017.12.010. [Epub ahead of print]
pOpt2_cCA_gLuc_i3_AGPP3’_Hyg
$30.00
$30.00
From Kyle Lauersen, Olaf Kruse lab, Bielefeld University-Germany, November 2017
Host strain: DH5α
Selection in E. coli: ampicillin
Selection in C. reinhardtii: hygromycin B
Reporter: Gaussia princeps Luciferase
Wichmann J, Baier T, Wentnagel E, Lauersen KJ, Kruse O. Tailored carbon partitioning for phototrophic production of (E)-α-bisabolene from the green microalga Chlamydomonas reinhardtii. Metab Eng. 2017 Dec 16. pii: S1096-7176(17)30395-6. doi: 10.1016/j.ymben.2017.12.010. [Epub ahead of print]
pOpt2_mVenus_Ble
$30.00
$30.00
From Kyle Lauersen, Olaf Kruse lab, Bielefeld University-Germany, November 2017
Host strain: DH5α
Selection in E. coli: ampicillin
Selection in C. reinhardtii: Zeocin
Reporter: YFP
Wichmann J, Baier T, Wentnagel E, Lauersen KJ, Kruse O. Tailored carbon partitioning for phototrophic production of (E)-α-bisabolene from the green microalga Chlamydomonas reinhardtii. Metab Eng. 2017 Dec 16. pii: S1096-7176(17)30395-6. doi: 10.1016/j.ymben.2017.12.010. [Epub ahead of print]
pOpt2_mCerulean3_Ble
$30.00
$30.00
From Kyle Lauersen, Olaf Kruse lab, Bielefeld University-Germany, November 2017
Host strain: DH5α
Selection in E. coli: ampicillin
Selection in C. reinhardtii: Zeocin
Reporter: CFP
Wichmann J, Baier T, Wentnagel E, Lauersen KJ, Kruse O. Tailored carbon partitioning for phototrophic production of (E)-α-bisabolene from the green microalga Chlamydomonas reinhardtii. Metab Eng. 2017 Dec 16. pii: S1096-7176(17)30395-6. doi: 10.1016/j.ymben.2017.12.010. [Epub ahead of print]
pOpt2_gLuc_Ble
$30.00
$30.00
From Kyle Lauersen, Olaf Kruse lab, Bielefeld University-Germany, November 2017
Host strain: DH5α
Selection in E. coli: ampicillin
Selection in C. reinhardtii: Zeocin
Reporter: Gaussia princeps Luciferase
Wichmann J, Baier T, Wentnagel E, Lauersen KJ, Kruse O. Tailored carbon partitioning for phototrophic production of (E)-α-bisabolene from the green microalga Chlamydomonas reinhardtii. Metab Eng. 2017 Dec 16. pii: S1096-7176(17)30395-6. doi: 10.1016/j.ymben.2017.12.010. [Epub ahead of print]
pOpt2_Clover_Ble
$30.00
$30.00
From Kyle Lauersen, Olaf Kruse lab, Bielefeld University-Germany, November 2017
Host strain: DH5α
Selection in E. coli: ampicillin
Selection in C. reinhardtii: Zeocin
Reporter: GFP
Wichmann J, Baier T, Wentnagel E, Lauersen KJ, Kruse O. Tailored carbon partitioning for phototrophic production of (E)-α-bisabolene from the green microalga Chlamydomonas reinhardtii. Metab Eng. 2017 Dec 16. pii: S1096-7176(17)30395-6. doi: 10.1016/j.ymben.2017.12.010. [Epub ahead of print]
pOpt2_mRuby2_Ble
$30.00
$30.00
From Kyle Lauersen, Olaf Kruse lab, Bielefeld University-Germany, November 2017
Host strain: DH5α
Selection in E. coli: ampicillin
Selection in C. reinhardtii: Zeocin
Reporter: RFP
Wichmann J, Baier T, Wentnagel E, Lauersen KJ, Kruse O. Tailored carbon partitioning for phototrophic production of (E)-α-bisabolene from the green microalga Chlamydomonas reinhardtii. Metab Eng. 2017 Dec 16. pii: S1096-7176(17)30395-6. doi: 10.1016/j.ymben.2017.12.010. [Epub ahead of print]
pOpt2_cCA_gLuc_i3_AGPP3’_Ble
$30.00
$30.00
From Kyle Lauersen, Olaf Kruse lab, Bielefeld University-Germany, November 2017
Host strain: DH5α
Selection in E. coli: ampicillin
Selection in C. reinhardtii: Zeocin
Reporter: Gaussia princeps Luciferase
Wichmann J, Baier T, Wentnagel E, Lauersen KJ, Kruse O. Tailored carbon partitioning for phototrophic production of (E)-α-bisabolene from the green microalga Chlamydomonas reinhardtii. Metab Eng. 2017 Dec 16. pii: S1096-7176(17)30395-6. doi: 10.1016/j.ymben.2017.12.010. [Epub ahead of print]
pOpt2_cCA_gLuc_i3_Spect
$30.00
$30.00
From Kyle Lauersen, Olaf Kruse lab, Bielefeld University-Germany, November 2017
Host strain: DH5α
Selection in E. coli: ampicillin
Selection in C. reinhardtii: spectinomycin
Reporter: Gaussia princeps Luciferase
Wichmann J, Baier T, Wentnagel E, Lauersen KJ, Kruse O. Tailored carbon partitioning for phototrophic production of (E)-α-bisabolene from the green microalga Chlamydomonas reinhardtii. Metab Eng. 2017 Dec 16. pii: S1096-7176(17)30395-6. doi: 10.1016/j.ymben.2017.12.010. [Epub ahead of print]
- «Previous Page
- 1
- …
- 11
- 12
- 13
- 14
- 15
- Next Page»